Skip to main content

Table 3 List of genes and isoenzymes used

From: The molecular genetic linkage map of the model legume Medicago truncatula: an essential tool for comparative legume genomics and the isolation of agronomically important genes

Markers Nature Function Primer sequences (5'-3') RE LG References
ENBP1 SSR Chloroplastic protein L: CACTTCCCACTGTCCTAGTCCTAC R: GACTCGTCATCACCAGTTTCATCC   1 [65]*
ENOD8 CAPS Nodulin L: ATGGTGCAAACTTCGCATCAGGAGG R: ACAACCCTTTGGTCCTGTGCCGTG SspI 1 [66]
MtPT-1 CAPS Phosphate transporter L: TTGCTAAGAACCCGAAACAAGCTGC R: ATGTTCATGATCCTTCTTGCTCAAGC RsaI 1 [13]
PEPC CAPS PhosphoEnolPyruvate Carboxylase L: CTCATCCTACTCAGTCGGTTCGTCG R: ACACGTAGCTCATCGTTGCAACGCC RsaI 2 [67]
Z-F1 RFLP Zn-Finger1   EcoRI 3 [68]
GS.B PCR Glutamine synthetase L: AGAAGTAGCGTGGTGGC R: GCTGCCTATGGAGAAGG   3 [69]
Mtlec2 SSR Lectine 2 L: AAAGAATTCCATCTTCCAAGGCGA R: GAAGTCTAGAAACCAATCCTTACCC   3 [70]
ENOD12 PCR Nodulin L: CCTGCTTATAGGCCACCAC R: CTTCTGCTGGAGGATGCC   3 [71]
ATPase SSR Vacuolar ATPase L: GGGTTTTTGATCCAGATCTT R: AAGGTGGTCATACGAGCTCC   4 [15]**
MtST-1 PCR Sucrose transporter L: ATCAAAGGTGGATGGGGATGGAG R: TAGACCAGAAGGGATGTGATTTCC   4 [72]
PGM Isoenz. PhosphoGlucoMutase    4 [34]
Gs.C CAPS Glutamine synthetase L: GCACAAGGAGCACATTG R: GCCCATAATTAAACATCATG VspI 5 [69]
Lb I CAPS Leghemoglobin I L: GATAGTCCTCAACTCCAAGC R: CCTGTTGCTCGAAGTTGAGA SspI 5 [73]
rDNA CAPS 45s Ribosomal DNA L: ATGGTCCGGTGAAGTGTTCG R: CCCGGTTCGCTCGCCGTTAC XbaI 5 This paper
ENOD40 CAPS Nodulin L: TTAGTAGGATCTTCTCTTTCACTAGC R: GCCTCCGATTATCAAAGGTCAAG AluI 5 [74]
GS.A PCR Glutamine synthetase L: AAAGACAAGTGGTTGTGAC R: GCTGCCTATGGAGAAGG   6 [69]
MtN1 PCR Nodulin L: ATCTATCTTCTTCGCTC R: TGACTGTTGAACATCTC   6 [75]
GSHS SSR Glutathione synthetase L: AGCAATAGGCAATGGCTGCTCCTGC R: AATGGTGAGATGCTTATGATGAGAC   7 [76]
VR CAPS Vestitone reductase L: GAGTGTGTGTAACTGGAGGTACAGG R: ATGCCTAATGCGCCATCGACGGTTC DdeI 7 [77]
PGD Isoenz. PhosphoGlucoDeshydrogenase    7 [34]
ENOD16 RFLP Nodulin L: ATCGGGACACTCTTTAGCAAGACCC R: TGGGCGGTGGAATTGGACCTCTTG EcoRV 8 [78]
  1. Underlined markers have been used for synteny studies RE : Restriction Enzyme LG : M. truncatula Linkage Group SSR : Simple Sequence Repeat: polymorphism is revealed by the length of the amplified fragment CAPS : Cleaved Amplified Polymorphic Sequence : polymorphism is revealed after digestion of the amplified fragment with restriction enzymes PCR : Polymerase Chain Reaction : polymorphism is revealed by the length of the amplified fragment L : Left primer R : Right primer *: Accession n° AJ002479 ** : Accession n° AA660456
\