Skip to main content

Table 2 Information of the primers used for high resolution melting (HRM) analysis

From: Identification of candidate genes for drought tolerance by whole-genome resequencing in maize

Primers Target gene (ID) Product size Annealing temperature Primer sequence (5′-3′) (bp)
   (bp) (°C)  
1 GRMZM2G072292 88 62 F: GCAAGCGGGGACATGAGC
    R: TCTTGGAGAAGCCCAGCGA
2 GRMZM2G055844 69 62 F: TATGTCCAGTCAGCGAGAG
    R:GGCTATGTCCACGATCATTG
3 GRMZM2G386229 68 62 F: GAGGCGTTCTACTCCGAG
    R: AGCGACAGGAGACAGTAC
4 GRMZM2G467339 90 59 F: GTATGTCTTAATAGGTATGTCTCA
    R: GTACACCCGATGTTCTTC
5 GRMZM2G109448 70 60 F: GCTGTCTCATCCTCATCG
     R: CCAATCTGTGAAGAAGTGAAG