Skip to main content

Table 1 Characteristics of 74 polymorphic microsatellite loci developed in grasspea (FP = forward primer, RP = reverse primer, Ta = annealing temperature)

From: Large-scale microsatellite development in grasspea (Lathyrus sativus L.), an orphan legume of the arid areas

Primer Repeat motif Primer sequence (5′-3′) Real product size(bp) Ta/°C
G119 (CA)6cgacacacncgcgcgcgcgacacac(ACG)8 FP-CGTCTCTTCAAAGGGCCATA 190-200 52
G120 (CA)6cgcacgcacgcacacagacacg(CA)7 FP-GCGCACGCATACATACACA 160-170 54
G131 (CA)7aacacgttcg(CA)8 FP-GCGCTCACACCAACATAAAG 140-150 54
G133 (CA)7cgcacat(AC)6 FP-ACGCGTGCACACATTTTATC 200-220 52
G136 (CA)7tacacacacat(AC)7aa(AC)6 FP-ACGACGACCACCAGTACGA 110-130 54
G142 (CA)8cgcacaa(AC)10 FP-CGTGCACGCACAGATACG 160-180 52
G143 (CA)8cggcgcgcg(AC)9 FP-GACACACACAACCCGAACAC 230-260 52
G145 (CA)8tacgcacg(CA)10 FP-ATACAAGCACGCATCCACAG 100-120 52
G154 (CAA)5agaccacaacaccaccacc aacaacaacaataataaaacag(AAC)5 FP-CTGGCGTAATAGCGAAGAGG 240-260 56
G205 (GT)7gcgtgtgcctgcgtctctgcgagtgcgtgc(GT)6 FP-TGTCTGGTGTGTGTGGTGTG 230-250 52