Skip to main content

Advertisement

Table 1 Characteristics of 74 polymorphic microsatellite loci developed in grasspea (FP = forward primer, RP = reverse primer, Ta = annealing temperature)

From: Large-scale microsatellite development in grasspea (Lathyrus sativus L.), an orphan legume of the arid areas

Primer Repeat motif Primer sequence (5′-3′) Real product size(bp) Ta/°C
G1 (A)10 FP-AAGGAGCAGCAGCATTTGTT 210-240 52
RP-TAATAATGGGGAGCCGATCA
G4 (AAAG)5 FP- CCTTTCGGAGCAATCAAGAC 110-120 56
RP- TGCCTAAGCATTGGCTTTCT
G5 (AAC)10 FP- CACAACCAGTTGCATCAGTG 200-220 56
RP- TGGCTCACATGATGGTTTGT
G6 (AAC)12 FP- TGGAGGACGAGCAACAATAA 230-250 54
RP- TGTTGTTGATGGAAACAAATGA
G7 (AAC)5 FP- ACAGCAAGAAGCAGCAACAG 230-245 56
RP- AGTTGGTTGTTGTGTCGTTGT
G9 (AAC)6 FP- CAACCAGAGCAACCACAAGA 240-260 56
RP- GGTTGCAAGAGGTTGCAGAT
G13 (AACCA)5 FP-CAAACCAAACCAAACCAAACT 180-195 52
RP- CGCGTTTTGGTTTTCGTACT
G15 (AAG)6 FP- TCAAGCCCAAAGTGAGATGA 145-155 56
RP- TTTTGTGTTGCTTGCTGACC
G17 (AAT)5 FP- CAGGTCCGGCTTATCTCTCA 180-200 56
RP- TTGGTTTCAACCCACTCCTC
G18 (AC)10 FP- ACACGACACACACGACAGTG 130-140 52
RP- CTGCGTGTCTGTGCCTATTG
G27 (AC)18 FP- ATCTTACCGGGGATCCATTC 190-210 56
RP- CTTCCCCATTCTCTGGTGTT
G33 (AC)6 FP- ACCAAAGGATGCAGGGTCTA 230-270 54
RP- TAGTCGTGGTGTCGTGGTGT
G39 (AC)6 FP- CCAGACACACACGCAAACAT 170-190 54
RP- GTGTGTGACGTTGCCGTTAG
G49 (AC)7 FP-ACGCACACACGGAAGAAAG 160-180 56
RP-GTGTGCGCATGTGTGTATGA
G61 (AC)8 FP-CACACACCATTACGCACACA 130-150 54
RP-TGGTGTCGTGGTCGTAGGTA
G64 (AC)8 FP-GCACATTCGCACGTATTCAC 160-180 56
RP-CGTTTCTGAGTGCGTTGTGT
G67 (AC)9 FP-CACCCTCTTCACTGCCTAGC 120-150 52
RP-TTGGGGGTTGTAGAAGGAAC
G68 (AC)9 FP-GCACACAAGGGCACACTG 170-180 52
RP-TGCGTCGTGTGTATGTGTTG
G72 (ACA)5 FP-CAACGACAACAACGCAAAAC 260-280 52
RP-TTCGCGGTTTGTCCATTTAG
G73 (ACA)5 FP-CCAACTCTCAGCCACGAACT 200-220 54
RP-TTGCTCCACCTACGCTTCTT
G75 (ACA)6 FP-AACAACAGCAGCAACAACAAT 200-215 54
RP-CGTGTTGTGTGTTCGTTCGTA
G76 (ACA)6 FP-CACAACCAACGCCAATACAG 230-250 54
RP-CCGTAGTACCGCGCTTATTC
G77 (AAC)11 FP-ACAAGACAACATCACCGAGAC 300-330 52
RP-TGTTGTTTGGTTGTTCGTGTA
G80 (AAC)5 FP-AAACACAACAGACGATTAAACACA 185-200 52
RP-TCTTGCTATGTAGTGTTGTGTGATG
G81 (ACG)5 FP-CGCACACACTCACACACAAC 180-200 52
RP-GGTCCTGTCGTCGTAGTCCT
G83 (ACG)7 FP-GGGCACACATTCTCACACAC 190-200 54
RP-TGTCGTCGTGTCGTAGTCGT
G87 (AG)15 FP-CCCTTACCGAGTGCAGAAAA 230-250 54
RP-CACCACGACTTGCTCACCTA
G101 (CA)11c(CA)7 FP-TGGCAGGTAACTGGTGAGTG 180-190 52
RP-GGTGTTTCCCCACCTCTCTA
G102 (CA)12 FP-AAAGCACAGCACAACACGAC 260-280 54
RP-AACAAGGACGACGGTAGGTG
G110 (CA)6 FP-CACAAACACGCACAAACACA 150-170 52
  RP-CGTCGGTATAACCGTGTCGT
G116 (CA)6(CACACG)5 FP-CACACAGGACAGCACTCACA 150-180 52
RP-GTCGTCGGTGTGTCGTAGTC
G119 (CA)6cgacacacncgcgcgcgcgacacac(ACG)8 FP-CGTCTCTTCAAAGGGCCATA 190-200 52
RP-CGACCGACCGACGTACTACT
G120 (CA)6cgcacgcacgcacacagacacg(CA)7 FP-GCGCACGCATACATACACA 160-170 54
RP-TTGCCGTTGTCGTGTTAGTG
G123 (CA)6gn(AC)6 FP-CATAACAACACGCAGCATTACC 130-140 52
RP-TTGCGTTGTTGTGTTGTGTTT
G128 (CA)7 FP-CCACACACCCACATGTTCA 210-230 56
RP-TTGTGGTGGGTCTGAGAGTG
G131 (CA)7aacacgttcg(CA)8 FP-GCGCTCACACCAACATAAAG 140-150 54
RP-TGTATGCGTGCGTATGTCTG
G133 (CA)7cgcacat(AC)6 FP-ACGCGTGCACACATTTTATC 200-220 52
RP-TATGTGGGCGCGTGTAAGTA
G136 (CA)7tacacacacat(AC)7aa(AC)6 FP-ACGACGACCACCAGTACGA 110-130 54
RP-ACGAGTGCGTGTGTGAGTGT
G142 (CA)8cgcacaa(AC)10 FP-CGTGCACGCACAGATACG 160-180 52
RP-GTGTGTGTGTTCGTCGTTTG
G143 (CA)8cggcgcgcg(AC)9 FP-GACACACACAACCCGAACAC 230-260 52
RP-TGAGCGAACGTACGTGGTAG
G145 (CA)8tacgcacg(CA)10 FP-ATACAAGCACGCATCCACAG 100-120 52
RP-AGTTCGTGTCGTGTCGTGTC
G147 (CA)9 FP-CGTCACACACGTCACGTACA 210-230 54
RP-CTACGAGACGCACGACGATA
G150 (CA)9 g(AC)25 FP-CACACACACCAAGCGTTACA 140-160 54
RP-TCGTGTGTGTCGTGTGTGTAG
G151 (CAA)10 FP-CAACAACGACAACAAAATTGTAA 175-185 52
RP-CTGCTGATGTTGTTGGTGCT
G154 (CAA)5agaccacaacaccaccacc aacaacaacaataataaaacag(AAC)5 FP-CTGGCGTAATAGCGAAGAGG 240-260 56
RP-TGTGTTGCTTTGTGTTGTCGT
G157 (CAA)6 FP-ACATCCAATCCCCACCATAA 210-230 56
RP-AATGCATGGTTGTTGCTTGA
G165 (CGA)5 FP-GAACGTACGACGACACGAACT 270-290 54
RP-CGTGTGGTGTGTGTGTGTGT
G171 (CT)9 FP-CTTCACTGCATGCTTTCCAC 200-230 52
RP-CTGGGGTGGTTTTTGTCAGT
G174 (GA)19 FP-CACAAGGGTCAAGGGAGAGA 140-160 52
RP-GTTTACGTTACTTATTCGTTCGTTAG
G184 (GT)15 FP-GCGTGTGTGCGAATGTGT 180-190 52
RP-CACGCACGCACACTAGACTAC
G185 (GT)19 FP-TGCGTGTGTCGCTCTATCAT 130-135 56
RP-TACTGCGACAACCGAACGTA
G188 (GT)6 FP-GCGCGTTAGTGTGTGTTTGA 140-150 52
RP-CACGCACGCACACTTACATA
G191 (GT)6 FP-TGTGCGTGGTGTTTGAGTG 140-160 52
RP-CACATACGCACAGCCCATAC
G192 (GT)6a(TG)7 FP-TGCGTGATAAGGTGCTTGAG 160-170 56
RP-ACACACACACGCACACACAC
G200 (GT)7 FP-GGATGGTGTGCTGTGTGTGT 120-135 52
RP-AACACCAACTACCGGCAACT
G205 (GT)7gcgtgtgcctgcgtctctgcgagtgcgtgc(GT)6 FP-TGTCTGGTGTGTGTGGTGTG 230-250 52
RP-CGACACGTACGCAACGAC
G206 (GT)8 FP-AAACTGGCCCTGCATTTTC 190-210 52
RP-GGTCATGGCAATTTGAGACA
G209 (GT)8 FP-TTTGCACGTGTCCTGTGTTT 240-260 52
RP-ACGACGACCACACACCACTA
G211 (GT)9 FP-ATGGCGTCGTATGTGTGTGT 200-210 52
RP-GTTACGGCCGAATCAACAAC
G219 (GTT)10 FP-CCAGTTGTGCCGAACACAT 130-160 52
RP-CCAACAGCAGATTGCCAGTA
G225 (GTT)7 FP-GGGCAGTGGACCAGTTAGAG 250-270 52
RP-CCGAGGGAATAAACGACAAA
G228 (T)10 FP-CCTACGGACATGCCTGTTTT 280-310 52
RP-GCGGTAGGGGAAAAACAACT
G233 (TC)20 FP-CGTTCGTCCTTCTCCTCCTA 120-140 52
RP-AGACGACTACGGACGACGAC
G234 (TC)7 FP-GTTGGGTTTGGCATTGAACT 190-210 52
RP-GAAGGGGCGAACAAATAAAA
G244 (TG)6 FP-CAATCCGAAAATCACCACCT 230-250 52
RP-GCACTCACATGCACACAAAC
G245 (TG)6 FP-CGTTGGTTGTTAGTCGGTCA 240-260 52
RP-GAACGAAACAACGACGACAA
G249 (TG)6c(GT)7 FP-TATGTGTGCAACGGCAACTT 140-160 52
RP-GCACACCCACCACACAATAG
G254 (TG)7 FP-TGAGTGCGTACGTGTGTCTG 100-120 52
RP-GCGCGTGTTCACACATAGAC
G262 (TGGT)5 FP-TGTGCGTGTGTGTGTTTTTG 300-320 52
RP-ACCACAACCCCTACCCTACC
G268 (TGT)5tattn(TTG)6 FP-TTGTTTGTTGTTGTTGTGTCTTG 290-305 52
RP-CTACAGTACAGACCCGCCACT
G269 (TGT)6 FP-ATGCTGTTGATGCGTCAGTT 220-240 52
RP-TGCAGCAACAACAAATAAGACA
G273 (TGT)7 FP- TTTTTGGTATTGTTGTTGTCGT 250-270 52
RP- CTGCAGCAATAACAGCATCAG
G284 (TTG)6 FP-TGTGTTGTGTTGTGCTGTATGTA 160-170 52
RP-GCAGCAACATTAAAACGAACAG
G285 (TTG)6 FP-TTTGTGCGGTTGATGTTGTT 190-200 52
RP-CTACGTCAGCCCGTCATACC