Skip to main content

Table 1 List of sequences and primers designed to perform SemiQ RT-PCR experiments

From: Characterization of the glutathione S-transferase gene family through ESTs and expression analyses within common and pigmented cultivars of Citrus sinensis(L.) Osbeck

GST class Sequence ID Primer features
   Forward (5′-3′) Reverse (5′-3′) Annealing temperature (°C) Expected amplicon (nt)
Tau CITSI24:CX077363 TCGGCATGGAAGAAGTGAAGCTACTGGGA ACCGTTCAAAAGATAGTGTCTATGAAGTA 65 784
CITSI47:3 TCGCCAAGCCCATTTGTGATGAGGGCA ACGAGACAGGCTGCTGCCTAGTCCGA 66 866
CITSI57:1 AGTAAGCTTCTGTAATAATGGCGGACGA ACAATACCCTAAGATAACAGTCGGGGACA 64 879
CITSI43:1 TCTGTCACAATGGCGGACGAAGTGGT AGCAGGCAGCACGATTGCGCTGCT 68 732
CITSI16:1 TCACTCGCCCTTAATTCTCAGTAAGGT AGATTGACGCCACATAATATTCCCA 60 966
CITSI53:1 TGCTGGGTTACTGGGCAAGCCCCT ACCTTCATGCATGGGCAACCGCTGA 66 686
CITSI41:1 GTTTACAGGGTGATTTGGGCTCTGA ACCACTATGCTAGTCCCCCGAACT 63 757
CITSI25:1 AAGCTCTATGGCACATGGGTAAGCCCTT ACACAGAGAGAGAGCTAACCCAATCA 65 730
CITSI51:1 TGGCCAAGCCCGTTTGTGTTTAGGGT AGACTTTCCACACAACATCACACTAC 63 756
CITSI36:1 GCGAAAATAATATGGCCAAAGAAGTGACGCT GTCATTACAACACACCACAACACCACCT 64 765
CITSI04:1 AGACGTGGTCAAGCCCCTTTGGT TGGAATGGGAAAAGGGCAAAAGGA 62 889
CITSI44:1 GCAGAAGATTATGGCAACAAAAGTG GAGCGTACAGAAAGGAGACACGTGCA 62 764
Phi CITSI52:1 AAGCTCTTCGAATCAAGGGCAATCACCCAA TTTTGATAAACCCATTGGGACAGTCGT 65 800
CITSI38:CK934228 ATACGAATCTCGAGCTATCATAAGGTACTA (a) TTTTCTCCCAAGGCCCCAAGCATTT 64 636
CITSI23:1 ATACGAATCTCGAGCTATCATAAGGTACTA (a) TTTTGTCCTCCAAGGCCCCAAGCAT 64 638
CITSI34:CK939385 ATACGAATCTCGAGCTATCATAAGGTACTA (a) TTTTGTCCTCCAAGGCCCCCAGCAT 65 678
CITSI33:1 TTTATACGAGTCGCGAGCTATCATGAGGT TTTTAAAGCTCCAACTCCAAACAT 60 658
CITSI05:DY257328 ATTTTATACGAGTCGCGAGCTATCATGAGG ACCCCTTATCCAAGGAACATTTCCCA 64 565
CITSI11:1 TGGGGATTTTACTCTATACGAATCGCGA ATGGCGACAACAAGAAATCGCCGCA 63 640
DQ198153 (CITSI02:1 + CITSI00:1) GCTTTTTGAGTCGAGGGCAATCATAAGG GATAACAGTAATGACAGCCAGCCGAA 64 549
CITSI29:1 AGGATGAGAAAATCTCCCTCTTAGAGTCT TGGGAAATTATTAGACCATGCCA 63 748
CITSI18:1 ATTTGAATCTAGAGCAATGACAGCATACGT CATCAATGTAAAATCATCACGCAACCA 63 599
Lambda CITSI46:1 CCTCCAAGATAGGCCCGCTTGGTAC TCCAGCAACGTACACAAGCTCACATCGGCA 66 672
Zeta CITSI21:1 ATGCTGAAACTGTATTCATACTGGAGGAGT TGCTGCTTATTGAGGGTCAACAAAGGCTG 64 880
Mapeg CITSI20:1 CGACTCGACTATGGCGGATGCAAC CTATGAGCTTATGCTTGCGCCATGCAGC 66 638
  1. GST classes, oligonucleotides sequences and the expected size of amplicons (on the basis of correct maturation) are highlighted. Uppercase letters indicated the use of the same forward primer.