Skip to main content

Table 1 Primers used in this study

From: Involvement of plant endogenous ABA in Bacillus megaterium PGPR activity in tomato plants

   Annealing
Primer Sequence Temperature (°C)
SlActin For 5′ - TCACCACCACTGCTGAACGGGA-3′ 58
SlActin Rev 5′ - TGGGCAACGGAACCTCTCAGC -3′  
SlPR1b For 5′ - GGGAGGGCAGCCGTGCAATT -3′ 58
SlPR1b Rev 5′ - TGCAACGTGCCCGACCACAA -3′  
SlACO4 For 5′ - TTCGCGCTCACACGGATGCT -3′ 58
SlACO4 Rev 5′ - CACCTCTAGCTGATCGCCGAGG -3′  
SlACS7 For 5′ - CGGTCTCCCCGGTTTTCGCA -3′ 58
SlACS7 Rev 5′ - GTGGCCGCGGAGACAACCAT -3′  
SlNCED For 5′ - ACAGCCGACCCACGAGTCCA -3′ 58
SlNCED Rev 5′ - GGTGTCCGGCGGTTGGTTCA -3′  
SlLE16 For 5′ - TCCCTTATCTCGAGGGTCGC -3′ 58
SlLE16 Rev 5′ - CGCTGTCTTCCGGTCTTCTG -3′