Skip to main content

Table 3 Sequences of oligonucleotide primers used for stress-responsive gene expression analysis

From: The cell morphogenesis ANGUSTIFOLIA (AN) gene, a plant homolog of CtBP/BARS, is involved in abiotic and biotic stress response in higher plants

Sequence description Sequence Number of bases AGI
DREB2-F TCGAGGAAAGGTTGTATGAGAGG 23 AT1G75490
DREB2-R AGAGTCGCTGCTGCTTTTTC 20 AT1G75490
COR15A-F ACTCAGTTCGTCGTCGTTTCTCAA 24 AT2G42540
COR15A-R GTTTGCGGCTTCTTTTCCTTTCT 23 AT2G42540
RD29A-F ATGAGAATGGTGCGACTAA 19 AT5G52310
RD29A-R CGTTGACCTTCCGTTGACCA 20 AT5G52310