Skip to main content

Table 1 PCR and real-time PCR primers

From: Fast-tracking development of homozygous transgenic cereal lines using a simple and highly flexible real-time PCR assay

Primer name Primer sequence (5′ – 3′) Product size (bp)
GWDcontrol_for (F) CGCCTTCTGGCTCAACAGTTC Endogenous gene; ca. 980
GWDcontrol_rev (R) TATCACCTTCACCTCCACGAC Construct: 568
JP_bx17pro5' (F) AACCATGTCCTGAACCTTCA 606
IB_GWD3rev (R) ATCTGTAAACCTGTCTTGTG  
qPCR Rint4-9 F ACATTAGCGAATAGCTGGATGAC 94
qPCR Rint4-9 R ACATTGATATACTTAGGCACAACCT  
qPCR NOS F TTGAATCCTGTTGCCGGTCT 127
qPCR NOS R GCGGGACTCTAATCATAAAAACCC  
qPCR EC ABD F GGGGAACACTATGGCCTCAA 79
qPCR EC ABD R TCCAGTTGAATTATCAAGGCCA  
qPCR EC A F ACCTGACCTTGTAAAACCATTCAT 104
qPCR EC A R TGACATCCTCCAACATCTCTAAC  
qPCR Rice SPS F AGAGATCGACGAAAAGCGGA 105
qPCR Rice SPS R TTTTCGGGATGATCCGAGCC  
  1. F = forward primer, R = reverse primer.