Skip to main content

Table 6 Oligonucleotide primer sequences used in the DNA constructions for the Y2H assays

From: Expression-based and co-localization detection of arabinogalactan protein 6 and arabinogalactan protein 11 interactors in Arabidopsis pollen and pollen tubes

AGI ID primer ID Forward primer Reverse primer
At5g14380 AGP6 ggggacaagtttgtacaaaaaagcaggctcggccgacgctccctcagcttctcc ggggaccactttgtacaagaaagctgggtcctaactcttgggtgactctgcagtgg
At3g01700 AGP11 ggggacaagtttgtacaaaaaagcaggctcggccgatgcaccttcagctgcacc ggggaccactttgtacaagaaagctgggtcctaacttttgggtgactcggcggc
At1g26630 FBR12 ggggacaagtttgtacaaaaaagcaggctcgaccttcctcttcccctcc ggggaccactttgtacaagaaagctgggtcctagtgcaaatagcaatgaatatc
At4g05320 UBQ10 ggggacaagtttgtacaaaaaagcaggctcgaaatcttaaaaactttctctc ggggaccactttgtacaagaaagctgggtcctaaaacaaaagaagcacagataat
At3g18040 MAPK9 ggggacaagtttgtacaaaaaagcaggctcggcgaaaagtttctcccttg ggggaccactttgtacaagaaagctgggtcctatgaagaaaacacacactttaac
At1g70810 CaLB domain family protein ggggacaagtttgtacaaaaaagcaggctcgaaaagagtcagagccgc ggggaccactttgtacaagaaagctgggtcctaaaaccaaaacgatttagg
At2g30020 AP2C1 ggggacaagtttgtacaaaaaagcaggctcgcgaaatcgaaatcaaaatatag ggggaccactttgtacaagaaagctgggtcctaaatttcggccaatgctcg