Skip to main content

Table 1 Forward and reverse primers for peach genes used in qPCR analysis of biosynthetic enzymes and candidate transcription factors

From: Transcriptional regulation of flavonoid biosynthesis in nectarine (Prunus persica) by a set of R2R3 MYB transcription factors

Gene Accession No./Prunus gene model Real time PCR primers (5’ to 3’)
    Forward     Reverse
Biosynthetic genes:
CHS AB094986 CAGAGATACCCAAAGGTTGGAAGGC AACCATCCTTCCCGACAGCGAT
ppa006888m
CHI DY634915 TGAAGACCTCAAGGAACTTCTCAATGG ACACAGGTGACAACGATACTGCCACT
ppa011276m
F3H AB097151 TCCGAGGGCAGAGCGAAGAAC TTGTGGAGGCTTGTGAGGATTGG
ppa007636m
DFR AB095030 GGTCGTCCAGGTGAACATACTGCC ATTTCTCATGCCATCCATGCCAC
ppa008069m
LDOX EU292219 AAGTGGGTCACTGCCAAGTGTGTTC GTGGCTCACAGAAAACTGCCCAT
ppa007738m
UFGT DN676790 CCGCTGCCTCTCCCAACACTC CCATCAGCCACATCAAACACCTTTAT
ppa005162m
ANR AM288300 ACTTCAAGGCTAAGGGGCTGCTG CCAAGCCAGATAAACGCCAATCAC
ppa008295m
LAR AJ872926 CATCCACGGGGAAATTCACCTG ACCCTTCCCAGAGTTACCATCACTGA
ppa007994m
FLS1 GU938685 GTTTTCTGACGGCAACGTTACGAA CCCAACCCTAGCGATAGGAGCC
ppa008322m
Regulators:    
MYB10 EU155160 TGATTCCAAGGGTCCACGCTAAAA CTGGTCTTGGGTTAGATGAAGAACTGC
ppa016711m
bHLH3 DY642427 TTCCTCTACTAGACGGCGTCGTCG GGAGGAGGATGGTGGTTGTGGTC
ppa002884m
WD40 ACQ65867 CCCAGCCTGATACCCCTTTGCT GTCGGCGAACGGATATCCAAAAT
ppa008187m
MYBPA1 CV047374 GACCCAAGCACCCACAAGAAATTATC GGCTTTAGTGGCTCCACATGTTGA
ppa009439m
MYB15 ppa004560m GGAAAATTGACACCTTCAGAAGGCC TCTACCGCCTCTTCGCTTGGAA
MYB16 ppa010277m AGCTTTTGACCAGAGGTATCGACCC TGCCCAGAAGCCCATTAATAATGC
MYB111 ppa010716m CGCTTATTGCTGGAAGGTTGCC GCCTATGGTTATTGGGATCAATGCC
MYB123 ppa023768m ACTCAACCGTCGACCAACATTGC TCGGCGTGGTGAGGAAAGATG
Reference gene:
PpActin BU045718 GGAAATTACTGCATTAGCACCCAGC CCAGATTCATCATACTCGGCTTTGG
ppa007214m