Skip to main content

Table 1 Overview of candidate genes investigated with EcoTILLING

From: EcoTILLING in Beta vulgaris reveals polymorphisms in the FLC-like gene BvFL1that are associated with annuality and winter hardiness

Gene Genomic size Protein domain(s) Amplicon size(s) Primer name and sequence (5’-3’) Length and portion of genomic sequence covered by EcoTILLING Portion of reading frame covered by EcoTILLING
BvFL1 8.62 kb MADS box/K box FL1a: 977 bp FL1b: 632 bp FL1a-fw tcggactttccctataagct FL1a-rv cacgtgaatcgttacagaca FL1b-fw gctgatagtctgtcccttttgtc FL1b-rv tgactccaacaccacgatgca 1,609 bp (19%) 62%
BvFT1 7.53 kb PEBP FT1a: 916 bp FT1b: 713 bp FT1a-fw tggtacgtgtatgaaacagaagctg FT1a-rv catcaactccatatttggggtg FT1b-fw acccatctatacttgtcgatgacc FT1b-rv caatggggaagtggttcacact 1,629 bp (22%) 92%
BTC1 11.27 kb REC, CCT BTC1: 996 bp BTC1-fw cagctgtaggatgttatcgtgctgag BTC1-rv agtaggtgataaggacaagacattgc 992 bp (9%) 15%
  1. The gene names, genomic sizes in kilo base pairs (kb), protein domains, sizes of amplicons in base pairs (bp) per gene, primer names and sequences, and the sizes of the amplicons in base pairs (bp) are given. Genomic size was defined here as the size of the genomic sequence of a gene from the start to the stop codon plus 1 kb each upstream and downstream. The genomic size given for BvFL1 refers to the known portion of the sequence. A large part of intron 1 was not sequenced (Reeves et al. [24]) and is not considered here. Furthermore, the length of the investigated genomic sequence and the percentage of the open reading frame which was investigated via EcoTILLING are given.