Skip to main content

Advertisement

Table 2 Primers used to amplify HKT1;5 from rice

From: Salinity tolerance, Na+ exclusion and allele mining of HKT1;5 in Oryza sativa and O. glaberrima: many sources, many genes, one mechanism?

Primer Sequence (5′ – 3′) Tm (°C) Size (bp)
Tile8For GTCGCCTCCCTCCAGCTAATGTACTGTC 78.7 3102
Tile8Rev GGCCTCCAACAAACTGAAAGCGTCAAT 79.6  
Tile9For GGCGGTGGGTGGTGCTTGGGTAGAGATA 83.9 1806
Tile9Rev GATGACAAGAGCGGCCGACAGTACATTA 78.8  
Tile10For CTACACTGAATTATACTGCGTGAAC 65.5 1390
Tile10Rev TAGAGCTCGACCAGATCCTGATATAGAC 71.1  
  1. Primers used to amplify HKT1;5 from O. sativa and O. glaberrima.