Skip to main content

Table 1 PCR markers designed based on five wheat expressed sequence tags (ESTs)

From: Genetic mapping and marker development for resistance of wheat against the root lesion nematode Pratylenchus neglectus

Marker EST Forward primer (5′-3′) Reverse primer (5′-3′)
wri1 BE445506 BE445506_F TCAGACAATTTAGTGGATGCTCG BE445506_R CCGCAAAGTAGCACGCCTT
wri2 BE445653 BE445653_F TGGACACTGGGTTCATCGAGGA BE445653_R AGCAAGCACACTAGCCACTCTGTTT
wri3 BF484041 BF484041_F TTCTCGCTGCAAAACTATGGC BF484041_R TTCACAGATCCAGTGCTTATGTCG
wri4 CN010180 CN010180_F1 ATGGGGCCTCTTCGG CN010180_R GSAAACATCTGTCTGATTACARAATAAGAA
   CN010180_F2 ATGGGGCCTCTTCGC   
wri5 BF483039 BF483039A_F2 GCAGCTACTTTGAACCCTTCAG BF483039_cpR1 CGACCGTCTTCCCGAACAGC