Skip to main content

Table 3 Description of amplicons characteristics used for restriction enzyme analyses

From: Vernalization treatment induces site-specific DNA hypermethylation at the VERNALIZATION-A1 (VRN-A1) locus in hexaploid winter wheat

Fragment number Primer name Sequence (5′-3′) Position of fragment within theVRN-A1gene (bp from start of Genbank accession AY747600) Size of amplified fragment (bp) Number of restriction site within amplicon for:
      MspI PspGI BstUI
0.0 k VRN_1_A_pr_F* GAAAGGAAAAATTCTGCTCG 44–527 483 8 1 (n.a.) 3
VRN_1_ex1_R* TGCACCTTCCCSCGCCCCAT
1.6 k 1.6 k-F GCCTCCACGGTTTGAAAGTA 1695–2358 663 1 0 2
1.6 k-R ATCTCAAGATTTTAGTTCCGATCCT
3.0 k 3.0 k-F TGCTGCAGTGATATTTTGTTAGC 3030–3710 680 0 1 0
3.0 k-R TGATGGGTCATAAGGTTTTGC
4.0 k 4.0 k-F CTTCCTTGGTGGGCTGTG 4003–4607 604 1 0 1
4.0 k-R TGGCTCTCCACCACAATACC
5.0 k 5.0 k-F GGCTAAGATCGTGAGGAAGG 5014–5648 634 0 1 0
5.0 k-R TGACTAGCACCACATCAATCG
6.8 k (b) 6.8 k (b)-F GCGGCATCATCTTCTTGC 6834–7148 314 1 0 2
6.8 k (b)-R GGCTACTCCTCCACCTTATGC
9.8 k 9.8 k-F TCTCCAGTCCTTCGGATTGT 9871–10489 618 1 1 0
9.8 k-R GGCTTTTGGGTTTCATCTCC
11.0 k 11.0 k-F AATGATTTGATACAGCAGCACAATA 11028–11710 682 1 1 0
  11.0 k-R ACCAATTCAAAAGATGGTTACTTGA      
  1. *PCR primers from [41]. Abbreviations: n.a.: not analyzed.