Skip to main content

Table 1 Characteristics of PCR amplicons used for bisulfite analysis

From: Vernalization treatment induces site-specific DNA hypermethylation at the VERNALIZATION-A1 (VRN-A1) locus in hexaploid winter wheat

Fragment number Primer name Primer sequence (5′-3′) Position of fragment within theVRN-A1gene (bp from start of Genbank accession AY747600) Size of amplified fragment (bp)
0.01 k(1) 0.01 k-F AAATGATTTGGGGAAAGTAAAATT 100–311 212
  0.01 k-R AAAAAATTTTTAAAAAAATCTAACCC   
1.2 k(1) 1.2 k-F ATTAAATTTGTGTTTGTTGTTTGA 1221–1468 248
  1.2 k-R AACTCTCTACTTTTTAATTTAACTCTTC   
2.2 k 2.2 k-F GGGGATAAGTAATTGTTATGTTTTG 2259–2490 233
  2.2 k-R ATCCAAAAAATCAACAAACTACAT   
6.8 k(a) (2) (3) 6.8 k(a)-F TTGTTTGTATGTGAGTAGATTGGA 6847–7147 301
  6.8 k(a)-R AACTACTCCTCCACCTTATACCAA   
7.6 k(4) 7.6 k-F TGAGGAGGTTGGAAGTATTAAGTA 7679–7393 315
  7.6 k-R TACACCCCTACAAAACTAAATCTT   
9.2 k 9.2 k-F ATGTAGTATGGATAAAATTTTTGAA 9203–9711 509
  9.2 k-R TTATTACTAAACCCTTCAAAAACTC   
10.1 k 10.1 k-F GTTGTAGTTTTAATTGAGGGATT 10130–10512 383
  10.1 k-R ACCCCTATCCATAACTAACTCT   
10.5 k 10.5 k-F AATTTGTTTGGGATTAAAGGTT 10592–10939 340
  10.5 k-R CAAAATCCTCTCCCATAAAATAC   
11.7 k 11.7 k-F GTGTTYGTTTTGGTTGTGTAGT 11792–12048 257
  11.7 k-R ACTCTAATTTCTTTTCCTTTCCC   
  1. Bold letters in the sequence represent primer positions matching cytosines, which were considered as non methylated and therefore converted into thymines after bisulfite treatment (Cs were changed to Ts in forward primers and Gs to As in reverse primers). (1)Primer pairs that were not genome A specific; (2)Fragment for which several primer pairs with different C/T content were designed (see Additional file 1); (3)While corresponding PCR amplicon contains a fragment of the Jorge transposon, the reverse primer does not overlap the annotation of this element. The closest Jorge element found shares only 76% nucleotide identity with this amplicon; (4)While the two primers are included within the Sumaya annotation, the closest Sumaya element found shares only 81% nucleotide identity with this amplicon.