Skip to main content

Table 6 Sequences of the used primers for gene expression analysis

From: Pythium species from rice roots differ in virulence, host colonization and nutritional profile

Gene Forward primer (5′-3′)a Reverse primer (5′-3′)a GenBank Accession no.
OsJAmyb GAGGACCAGAGTGCAAAAGC (3 μM) CATGGCATCCTTGAACCTCT (3 μM) AY026332
OsACTIN1 GCGTGGACAAAGTTTTCAACCG (1 μM) TCTGGTACCCTCATCAGGCATC (3 μM) X15865
  1. aThe concentrations for each primer stock are presented between brackets.