Skip to main content

Table 5 Sequences of the species-specific primers that amplify a part of the ITS1 region

From: Pythium species from rice roots differ in virulence, host colonization and nutritional profile

Pythiumisolate

Forward ITS primer (5′-3′)a

Reverse ITS primer (5′-3′)a

Size amplicon

GenBank Accession no.b

P. arrhenomanes PT 60

ATTCTGTACGCGTGGTCTTCCG (3 μM)

ACCTCACATCTGCCATCTCTCTCC (1 μM)

311 bp

HQ877857

P. graminicola PB912 132

ATGGCTGAACGAAGGTGGGCTG (1 μM)

TCCCGAAAGTGCAATGTGCGTTC (3 μM)

240 bp

HQ877865

P. inflatum PT 52

AGGTGGGCGCATGTATGTGTGTC (500 nM)

ACGTATCGCAGTTCGCAGCG (3 μM)

165 bp

HQ877856

  1. aThe concentrations for each primer stock are presented between brackets.
  2. bThe ITS-regions of P. arrhenomanes PB912 75 (HQ877857) and P. graminicola PB912 116 (HQ877865) are respectively identical to those of P. arrhenomanes PT 60 and P. graminicola PB912 132 [3].