Skip to main content

Table 4 Identified putative novel miRNA and read counts of the miRNA in the six libraries

From: Genome-wide identification of alternate bearing-associated microRNAs (miRNAs) in olive (Olea europaeaL.)

Novel ID Location Strand (+/−) Energy (kcal/mol) Sequence of 5p Sequence of 3p UF RF NON JON NOFF JOFF
(count) (count) (count) (count) (count) (count)
5p 3p 5p 3p 5p 3p 5p 3p 5p 3p 5p 3p
oeu_mir_1 scaffold_10:17226129:17226207 + −27.20 AAGAAGAAGAAGAACGAUGCCUC - 15 - 15 - - - - - - - - -
oeu_mir_2 scaffold_10:20223072:20223157 −36.30 - AUUCGGUUCGGUUCGGUUCGGUU 100 117 - 33 32 50 - 45 74 71 53 58
oeu_mir_3 scaffold_14:15500470:15500726 −49.71 - UGUCGACAUAGAAAUGAUUGGC - 13 - - - - - - - - - -
oeu_mir_4 scaffold_16:5755707:5756007 −69.50 - UCUUUGGAUUGUUUAACAUGGUA - 10 - - - - - - - - - -
oeu_mir_5 scaffold_16:12916010:12916345 −42.40 - UGAUGAUGAUGAUGACGACGACA - 14 - - - - - - - - - 5
oeu_mir_6 scaffold_19:8213709:8214023 + −50.83 UCUGAUACCAACUGAUGUGAACC UCUGAUACCAACUGAUGUGAACC 5 5 - - - - - - - - - -
oeu_mir_7 scaffold_19:15701744:15701856 + −32.20 UCUGUGUACAAUAAGCCGAUGCU - 59 - 6 - - - - - - - - -
oeu_mir_8 scaffold_1:34545837:34545992 + −37.10 AGUAGAAGACGCUCUGGUGAG - 10 - - - - - - - 7 - - -
oeu_mir_9 scaffold_1:387325:387591 −88.20 UGAUUGAGCCGCGCCAAUAUC - 51 - 39 - - - - - - - - -
oeu_mir_10 scaffold_1:12533361:12533445 −25.40 UCGGUUCGGGUUCGGUUCGGUUC - 16 - - - - - - - 9 - 13 -
oeu_mir_11 scaffold_2:18857579:18857663 + −34.80 GGUCGGUUCGGUUCGGUUCGGUU - 10 - 11 - 8 - 5 - 18 - 11 -
oeu_mir_12 scaffold_3:16233511:16233599 −31.52 AGAUGGAGAUGGAGAUGGAGAUG - 7 - - - - - - - - - - -
oeu_mir_13 scaffold_4:16304187:16304406 + −44.80 GCUGGAGUAGCUCAGUUGGUU - 55 - 167 - 64 - 24 - 83 - 36 -
oeu_mir_14 scaffold_5:13476318:13476427 + −40.21 - GAGGGGGAGUGUUGGCGUGAG - 22 - - - - - - - - - -
oeu_mir_15 scaffold_7:6284292:6284592 −46.40 UGUUGUUGUUGUUGUCGUCGUCA - 13 - - - - - 12 - - - - -
oeu_mir_16 scaffold_11:6066546:6066885 + −81.90 - UCCGUUGUAGUCUAGUUGGUU - - - 132 - - - - - - - -
oeu_mir_17 scaffold_12:2050403:2050549 −60.20 UCUUGCUCAAAUGAGUAUUCCA - - - 12 5 86 36 - - 12 12 - -
oeu_mir_18 scaffold_1362:5405:5632 −48.92 - GUUGUAGACAUGAAAGCGUAAGA - - - 28 - - - - - - - -
oeu_mir_19 scaffold_14:13968161:13968276 + −32.40 - GUUUGGUUCGGUUCGGUUCGGUU - - - 28 - 14 - 18 - 25 - 16
oeu_mir_20 scaffold_19:13198720:13199053 + −107.50 - UGGUGGUGGUGGUGGUGGUGACA - - - 12 - - - - - - - -
oeu_mir_21 scaffold_1:30807164:30807488 - −87.40 - AAUAUUUUUGAUCUUUUGGAU - - - 7 - 8 - - - - - -
oeu_mir_22 scaffold_5:4584254:4584466 + −39.20 - UGUCUGGACCAGUUUACGUGC - - - 12 - - - - - 11 - -
oeu_mir_23 scaffold_136:423:565 + −38.90 - GUUCGGUUCGGUUCAGUUCGGUU - - - - 7 10 - - - - - -
oeu_mir_24 scaffold_13:1053462:1053647 + −46.84 GAAGCUAUGAGAUCUGAGGG - - - - - 12 - - - - - - -
oeu_mir_25 scaffold_16:12933922:12934079 −56.90 UGGGGAAGACAGGCACAUGAA - - - - - 11 - 22 - 11 - 16 -
oeu_mir_26 scaffold_18:1471946:1472262 −66.60 - GGGGGAGGGGGAGAGAGAGAGAG - - - - - 5 - - - - - -
oeu_mir_27 scaffold_1:29385469:29385555 −37.30 UGGCGGUGGCGGUGGCGGUGGU - - - - - 7 - 6 - 5 - - -
oeu_mir_28 scaffold_1:31083890:31083975 −35.80 - GAUGGUGGGGUUGUGGGUGGC - - - - - 26 - - - 22 - -
oeu_mir_29 scaffold_1:34445830:34445942 −27.10 UUGACAGAAGAUGGAGAGCAC - - - - - 17 - 54 - 32 - 34 -
oeu_mir_30 scaffold_204:28760:28841 −32.55 GUUCGGUUCGGUUCUGUUCGGUU - - - - - 12 - - - - - - -
oeu_mir_31 scaffold_3:15576344:15576447 −51.20 UUCCACGGCUUUCUUGAACUUC - - - - - 194 - 212 - 88   588 -
oeu_mir_32 scaffold_4:14314575:14314936 −48.55 - UUUAAAGAGAUUGUUGUAAUU - - - - - 22 - 8 - - - -
oeu_mir_33 scaffold_16:2089550:2089717 + −34.00 AAAUUGGUCCGGACACCCAUA - - - - - - - 8 - - - 6 -
oeu_mir_34 scaffold_4:13969966:13970214 + −57.51 UGGAGGUGGAGGUGGCGGUGG - - - - - - - 20 - - - - -
oeu_mir_35 scaffold_1:42369615:42369709 −23.90 - GUUCAGUUCGGUUCGGUUCGGUU - - - - - - - - - 13 - -
oeu_mir_36 scaffold_13:1053462:1053647 + −46.84 GAAGCUAUGAGAUCUGAGGGC - - - - - - - - - - - 10 -
oeu_mir_37 scaffold_16:11530564:11530665 −26.60 AGGGGAGGGAGAGAGAGAGAGAG - - - - - - - - - - - 6 5
oeu_mir_38 scaffold_4:14079438:14079535 −39.30 UCUCGGUUCGGUUCGGUUCGGUU - - - - - - - - - - - 13 -