Skip to main content

Table 1 Candidate genes for SHR: sources of selection and features for genotyping the association mapping population

From: Association mapping in sunflower for sclerotinia head rot resistance

Source of selection Target locus Sunflower gene IDa Sequence lengthb SNPs in CSc Indels in CSd Haplotypes in CSe Genotyping methodf Primers for AMP genotyping
B. napus expression At1g34580  HaMT  580 (191) 8 (8) 3 (11) 3 (2) FCE F:5′GAAAGGACATGCTACTTTATGG3′
         R:5′CTTTACTTGAATTAAAGTTACT3′
profile At5g51550 HaPRP1 431 0 - 1   
    HaPRP2  437 (166) 11 (11) - 3 (2) dHPLC F: 5′GGACGGGAACGTAAAATAATG3′
         R: 5′CCGTCTGTCCGTACAATCG3′
  At3g48310 HaCYP450A 786 1 (0) - 2   
   HaCYP450B 310 2 (0) - 2   
    HaCYP450C  400 (260) 2 (2) 1 (1) 2 (6) dHPLC F: 5′AAGTGACTTTAGCAACGTCC3′
         R: 5′GAGTTGGTATGGGTGGATGAA3′
  At5g05940 HaROPGEF1 447 12 (11) 3 (50) 4   
    HaROPGEF2  403 (197) 2 (2) 2 (11) 2 (2) FCE F: 5′TGCGTAGTGGTTCTAAAATTGG3′
         R: 5′CGTCAATCATTACCCCAACC3′
   HaROPGEF3 801 0 - 1   
  At1g48040  HaPP2C  514 (398) 4 (4) - 2 (4) Direct sequencing F: 5′ACTGGGACTACGGCATTGAC3′
         R: 5′TGCTGAATTTCTGGCTCTGA3′
  At1g04450  HaRIC_A  940 (261) 8 (8) 4 (6) 3 (2) FCE F: 5′GCACGAATAGTGACATTGAAAC3′
         R:5′ACATAAAACAGTTTTCGGTCC3′
    HaRIC_B  1424 (537) 12 (0) 2 (15) 3 (3) FCE F: 5′GGCTTGCGTTACATCTCTGA3′
         R: 5′CCCAACTAGGAGCATTGGAA 3′
  At1g03687 HaHP1 198 0 1(1) 1   
  At4g09180  HaHP2  309 (256) 1 (1) - 2 (5) Direct sequencing F: 5′CTGCTATCCAGGCTCATTCA3′
         R: 5′AGAATGGCAGGGCGACCAAG3′
  At1g13200 HaFbox1 265 11 (11) - 3   
   HaFbox2 262 8 (5) 1 (1) 5   
  At1g14687  HaZFHD  166 (166) 9 (7) - 4 (9) Direct sequencing F:5′TCATGCCCTCACTAACATGC 3′
         R: 5′TTTGTCCGGAATCTTTTTCG 3′
Sunflower EST library TC49193 HaDRP 587 14 (12) 1 (1) 2   
  BQ973243 HaCP 542 14 (10) - 3   
  -  HaGDPDI  620 (707) 18 (14) 2 (2) 3 (10) Direct sequencing F: 5′CAGAAACTGATCAACCCGAAA 3′
         R: 5′TGCATGCATCTTGGAAAATAG 3′
  -  HaCWP  351 (177) 4 (4) 3 (10) 2 (2) FCE F: 5′CAGGAATCACGGTCCCTAGT3′
         R: 5′TGAAACATGAGGGATGAGCA3′
  TC42391  HaPI  658 (235) 14 (9) 3 (4) 5 (2) FCE F: 5′TCCAACAGTGTGTGACCTTTG3′
         R: 5′CATTAGTTACGTTACAAAGCTAT3′
  TC57179  HaPAL  343 (343) 2 (2) - 2 (2) dHPLC F:5′TGTGGTCTTCAAATTCATTAATAAC3′
         R: 5′GGCCATTCCTAACAGGATCA3′
Defense responses CF088675  HaWRKY5  1395 (227) 39 (33) 14 (56) 8 (6) FCE F: 5′CCGATCAAAGGCTCAATCTA3′
         R: 5′CACATCCGCTAGTTCACACC3′
  BU016906  HaWRKY7  1163 (174) 1 (1) 2 (22) 3 (2) FCE F: 5′CATTGTTGGTCAACCCTGTG3′
         R: 5′AGGGAAGCATAACCATGACG3′
  EU112647 HaGLP1 876 0 3 (3) 3   
  AJ540203 HaGLP2 794 6 (6) - 2   
  TC17527 HaGLP3 621 13 (9) - 6   
  TC18217  HaGLP4  761 (209) 9 (2) 3 (11) 4 (4) FCE F: 5′TGGCTGCAACAACTTTCCTT3′
         R: 5′TTCAATCCAGAAACAAACTTCTAA3′
  TC17648 HaGLP5 1710 2 (1) 2 (3) 3   
  1. a Acronyms used throughout this article, candidate genes genotyped in the AMP are underlined.
  2. b Length of PCR products sequenced in the CS. Length of PCR products genotyped in the AMP are given in parentheses.
  3. c Parsimony informative sites are given in parentheses.
  4. d Base pairs of indels are given in parentheses.
  5. e Number of haplotypes detected in the AMP are given in parentheses.
  6. f FCE: fluorescent capillary electrophoresis, dHPLC: denaturing high liquid performance chromatography.
  7. g Primers 5’-end 6-FAM labeled.