Skip to main content

Table 2 Gene-specific primers used for real-time RT-PCR amplification

From: Analyses of the sucrose synthase gene family in cotton: structure, phylogeny and expression patterns

Gene Forward primer Reverse primer
GaSus1 acgggttctggaagcatgtgtc ccccggcaacttcaatttcaat
GaSus3 cgccgtgagagtcgtcgttacc ccaagaaaaaccggcccaatg
GaSus4 gccgccgttacctggagatgt cccgcctcttcctttgttttac
GaSus5 cggccaatacgagagtcacatc cggcttgttgcggtcttttag
GaSus6 ggctgatgacattggctggagta cgcaatcaaccagacccttaaat
GaSus7 cgcgtttcgacatttatccttatc tgcgcaatcgtagcctgtgtt
UBQ7 gaaggcattccacctgaccaac cttgaccttcttcttcttgtgcttg