Skip to main content

Table 3 Sequences variations of regulatory element among different HMW-GS promoters

From: Novel variants of HMW glutenin subunits from Aegilops section Sitopsis species in relation to evolution and wheat breeding

Alleles E motif (TGTAACCC) N motif (TGAGTCAT) Partial Enhancer (TTTGCAAA) Enhancer (GTTTTGCAAAGCTCCAATTGCTCCTTGCTT ATCCAGCT) TATA box
(CTATAAAAG)
Start
(TTATCA)
1Ax2* TGTAAATC TGAGTCAC TTTGCAAA GTTTTA CAAAGCTCCAATTGCTCCTT GCTT ATCCAGCT CTATAAAAG TCTTCA
1Bx7 TGTAAATC TGAGTCAT TTTGCGGA GTTTTG C- AAGCTCCAATTGCTCCTT ACTT ATCCAGCT CTATAAAAG TCATCA
1Dx2 TGTAAACC TGAGTCAC TTTGCAAA GTTTTG CAAAGCTCCAATTGCTCCTT GCTTATCCAGCT CTATAAAAG TTATCA
1Dx5 TGTAAACC TGAGTCAC TTTGCAAA GTTTTG CAAAGCTCCAATTGCTCCTT GCTTATCCAGCT CTATAAAAG TTATCA
1S b x2.9 TGTAAATC TGAGTCAC TTTGCAAA GTTTTG CAAAGCTCCAATTGCTCCTT TCTTATTCAGCT CTATAAAAG TCATCA
1S l x2.9 TGTAAATC TGAGTCAC TTTGCAAA GTTTTG CAAAGCTCCAATTGCTCCTT TCTTATTCAGCT CTATAAAAG TCATCA
1S sh x2.9 TGTAAATC TGAGTCAC TTTGCAAA GTTTTG CAAAGCTCCAATTGCTCCTT TCTTATTCAGCT CTATAAAAG TCATCA
1Ay TGTAAATC CGAGTCAT deleted GTTTTG CAAAGCTCCAATTGCTCCTT GCTTATCCAGCT CTATAAAAG TCATCA
1By9 TGTAAATC TGATTCAT TCTACAAA GTTTTG CAAAACTCCAATTGCTCCTT GCTTATCCAGCT CTATAAAAG TCATCA
1Dy10 TGTAAATC TGAGTCAT TTTGCAAA GTTTTG CAAAGCTCCAATTGCTCCTT GCTTATCCAGCT CTATAAAAG TCATCA
1S b y2.2 TGTAAACC TGAGTCAC TTTGCAAA GTTTTG CAAAGCTCCAATTGCTCCTT GCTTATCCAGCT CTATAAAAG TCATCA
1S l y2.3 TGTAAATC TGAGTCAT TTTGCAAA GTTTTG CAAAGCTCCAATTGCTCCTT GCTTATCCAGCT CTATAAAAG TTATCA
1S sh y2.3 TGTAAATC TGAGTCAT deleted GTTTTG CAAAGCTCCAATTGCTCCTT GCTTATCCAGCT CTATAAAAG TCATCA
  1. The position of each variation is underlined in the corresponding locus of consensus sequences.