Skip to main content

Advertisement

Table 5 Sequencing primers designed each 500–1000 bp into the gamma-TMT gene

From: Genetic basis of unstable expression of high gamma-tocopherol content in sunflower seeds

Primer Sequence (5′-3′)
F90 GGATGAATCGTTTGTTATTG
F91 GTCAATGGAGAGTGGAGAGC
F92 AGGAAGAAAAAATCTTGAATAA
F93 ATCGCTTCATCATCATCATA
F94 CACTAAATTTGACATCCACAAC
F95 GCCACTAATGATTGAAGGATT
R94 ACCACAACGTAAAAATGTTT
R95 CCACTACGTAGCAATGAAGT
R96 CCTTTAGTTTGCCAATTCAC
R97 CCGAGTCAACTCACTAACAA
R98 TCATTCACAAACTGCAGTAG