Skip to main content

Table 4 Characterization of 14 additional sites (isolated from the mPing -specific TD profiles) flanking de novo mPing insertions in the S2 progenies of etoposide-treated plants

From: Changes in DNA methylation and transgenerational mobilization of a transposable element (mPing) by the Topoisomerase II inhibitor, Etoposide, in rice

Insertion site Insertion positiona Locus-specific primers Inserted into TIRs TSDs (5’-3’)
   (5’-3’) (S2 plant individuals) (5’-3’)  
mPing- mPL1 Chr.4; Position: for: tggtttgctgggacatgtaa 3-15,17,19 ggccagtcacaatgg TAA
  35202559-35203218 rev: gctcttgcataagagccaaca    
mPing- mPL2 Chr.2; Position: for: gcagccagtacgtagcacag 2,9,10 ggccagtcacaatgg TAA
  28002407-28003049 rev: acgaacgtgggctgttttag    
mPing- mPL3 Chr.5; Position: for: tttgtcggcgtctactccat 2,9,10 ggccagtcacaatgg TAA
  22152251-22152950 rev: tttgcagctggcttatagca    
mPing- mPL4 Chr.3; Position: for: gctcgtggctgaagacctta 2,9,10 ggccagtcacaatgg TTA
  9219105-9219744 rev: tcgtctctcggtgacacagt    
mPing- mPL5 Chr.12; Position: for: atgtgcactgtgcctggtag 2 ggccagtcacaatgg TTA
  838497-839154 rev: tctcgctctttcagtgagca    
mPing- mPL6 Chr.8; Position: for: cggagcacggagtacttatca 2,9,11-12,15-16 ggccagtcacaatgg TAA
  28053221-28053889 rev: gctctaaatcacctagccaacg    
mPing- mPL10 Chr.1; Position: for: tggctggtccttaccttttg 10-12,14-17,19 ggccagtcacaatgg TTA
  23659253-23659876 rev: gacgtggagaggtggaagag    
mPing- mPL15 Chr.3; Position: for: ttgagagcatccacaacgaa 2,9,10 ggccagtcacaatgg TTA
  12714414-12715082 rev: atcggcattagcacaaagga    
mPing- mPL26 Chr.2; Position: for: caaagccaaaacaaggatgc 9,10 ggccagtcacaatgg TTA
  13161847-13162504 rev: aagggcgcatattagcaaaa    
mPing- mPL29 Chr.4; Position: for: acaatcaatggcttccttgc 2,10 ggccagtcacaatgg TTA
  32802687-32803380 rev: ccaagtgtcatgcctgctta    
mPing- mPL30 Chr.1; Position: for: gtgggaagtgatgaggagga 2-4,8-10,18 ggccagtcacaatgg TTA
  30258277-30258933 rev: cgcgggggattagaatactt    
mPing- mPL35 Chr.8; Position: for: aaagagaaaagcagcggact 2 ggccagtcacaatgg TAA
  28053307-28054025 rev: aaatgacggttttgttttgc    
mPing- mPL36 Chr.11; Position: for: gccgcgagctaatgatagtt 2,8,10 ggccagtcacaatgg TTA
  392454-393170 rev: gtaaccctgccctgactcat    
mPing- mPL37 Chr.3; Position: for: tttacgtcaggggaatggac 1,7,8,10,14,16-17 ggccagtcacaatgg TAA
  17530417-17531150 rev: tccgcgttcttcagtttcta    
  1. a Based on BlastN at the NCBI website.