Skip to main content

Table 3 Characterization of 20 sites (isolated from the mPing -specific TD profiles) flanking de novo mPing reinsertions in the S1 progenies of etoposide-treated RZ1 plants

From: Changes in DNA methylation and transgenerational mobilization of a transposable element (mPing) by the Topoisomerase II inhibitor, Etoposide, in rice

Insertion sites Insertion positiona Locus-specific primers Inserted into TIRs (5’-3’) TSDs (5’-3’)
   (5’-3’) (S1 plant individuals)   
mPing-mPL7 Chr.11; Position: for: gaaactaacgcgtgcacaga 1,3-5,7-10,12,15-16,18-20,23,25-31 ggccagtcacaatgg TAA
  25106489-25107127 rev: gcgattcagcataacaccaa    
mPing-mPL8 Chr.3; Position: for: tcccattcaaagatgacgaa 1,3,6-12,14-22,25-31 ggccagtcacaatgg TAA
  20981135-20981762 rev: gaacacgaaacaacagaacacc    
mPing-mPL11 Chr.8; Position: for: atctccatcccctcacgac 1-5,7-8,11-12,14,16-19,21-32 ggccagtcacaatgg TTA
  1013283-1013920 rev: aaaagtgtcggaagctctgc    
mPing-mPL12 Chr.7; Position: for: gcacaggctccaagacgta 1-5,8-9,12-15,18-28,30,32 ggccagtcacaatgg TAA
  4559135- 4559798 rev: aaaaactgaccgttggatgg    
mPing-mPL13 Chr.4; Position: for: ggcaatggtgattcgttga 16-17,24-26,28-30 ggccagtcacaatgg TAA
  34469107-34469738 rev: tgcatgagagccaatactcc    
mPing-mPL14 Chr.12; Position: for: cccatttgaataccggatga 1,4-7,9-11,13-15,17-26,28-30,32 ggccagtcacaatgg TAA
  2733377-2734039 rev: ctgggcaacttggagtacg    
mPing-mPL16 Chr.3; Position: for: tttgcctttctgctgatcct 7,12-13,15,17-18,20-22,25-26,30,32 ggccagtcacaatgg TAA
  34531398-34532060 rev: aacgatgccaaagtatgctg    
mPing-mPL17 Chr.3; Position: for: gcaggcagatgttgatggta 1,3,6-9,11,14-15,18,20-23,27,30,32 ggccagtcacaatgg TTA
  9406004-9406679 rev: tttgcatgcttgcttggtat    
mPing-mPL18 Chr.3; Position: for: agcgatggtgcattggttat 1-33 ggccagtcacaatgg TAA
  9647556-9548216 rev: ggaagctgctgcttttgaag    
mPing-mPL19 Chr.1; Position: for: cgaatgcatcgataccactta 2-6,13,25-32 ggccagtcacaatgg TTA
  25587854-25588476 rev: taatggcccaattcaatgct    
mPing-mPL20 Chr.12; Position: for: tcaagaacagtgccaactcg 1,4-7,9-11,14-20,22-24,26,28-30,32 ggccagtcacaatgg TTA
  3284650-3285306 rev: catacgccctattccgttgt    
mPing-mPL21 Chr.4; Position: for: gtggagaaaatgggtgagga 1-3,7-8,17-22,27-30,32 ggccagtcacaatgg TTA
  34083700-34084342 rev: tacgggtgttgacatgaagc    
mPing-mPL22 Chr.2; Position: for: aaacccacggtttgcttttt 1-8,11,16-17,22-26,30-32 ggccagtcacaatgg TTA
  22543199-22543812 rev: ggaagacagagccactgagc    
mPing-mPL23 Chr.5; Position: for: atgcaaagatttggtgagca 1-33 ggccagtcacaatgg TTA
  19245393-19246079 rev: cccacacctttgatttttcg    
mPing-mPL24 Chr.3; Position: for: catgtgcgtggaaaacagag 1,3,6-12,14-22,24-32 ggccagtcacaatgg TTA
  21314690-21315373 rev: ggtgcggaacatgtcatcta    
mPing-mPL25 Chr.8; Position: for: tgaggcattgaggtgcacta 1,2-911-24,26-28 ggccagtcacaatgg TTA
  13161847-13162504 rev: cgctatattaatgccggttcc    
mPing-mPL28 Chr.2; Position: for: tatctgagcgtgagcgtgtc 2-7,9-10,12,15,17-26,28-30,32 ggccagtcacaatgg TAA
  29238347-29238998 rev: ttatttggggacgacctttg    
mPing-mPL31 Chr.6; Position: for: gtccgatggatcctactggt 1-33 ggccagtcacaatgg TAA
  30098290-30099010 rev: attaagcatgcatgggtgtg    
mPing-mPL32 Chr.8; Position: for: tcctcctactcctccacagc 1-8,12-14,16-32 ggccagtcacaatgg TAA
  4706504-4707237 rev: cacaacaggcaacctcaact    
mPing-mPL34 Chr.12; Position: for: aatcgcgaaaatgaactctg 1-33 ggccagtcacaatgg TAA
  9948317-9949045 rev: ggcacagctcctaacaggta    
  1. a Based on BlastN at the NCBI website.