Skip to main content

Table 2 Characterization of five mPing excision sites isolated from the mPing -specific TD profiles in the progenies (S1 generation) of etoposide-treated RZ1 plants

From: Changes in DNA methylation and transgenerational mobilization of a transposable element (mPing) by the Topoisomerase II inhibitor, Etoposide, in rice

Excision sites Excision position a Locus-specific primers (5’-3’) Excised from (S1 plant individuals) Excision footprint
mPT9 Chr.11; Position: for: tactgccttttgctccatcc 2,4-10,12-14,16,18-26,29-32 gcaagtgaatacTTA <mPing (430bp) > TTAggactactttga
  22698635-22699300 rev: caggctttgccaatagaaca   gcaagtgaatacTAA------------ggactactttga
mPT27 Chr.1; Position: for: tgtggttgtggtagctgcat 1,3-5,7-10,12-13,15,17-20,23-31 tgccatgtgctaTTA < mPing (430bp) > TTAtgcccggaggcc
  17840580-17841225 rev: ctgtaccgcacggcagtatt   tgccatgtgctaTTA------------tgcccggaggcc
mPL33 Chr.6; Position: for: gaggcaggagattagggttg 1-3,7-8,11,13-21,23-24,26-30 tctaatggttcaTTA <mPing (430bp) > TTAgggggtagtggg
  13736451-13737182 rev: gacaatgcccactgttagga   tctaatggttcaTTA------------gggggtagtggg
mPL38 Chr.3; Position: for: caacgcttcacctaaccaca 1-2,4-12,16-32 cagctacactctTTA <mPing (430bp) > TTAtgtggaagaaac
  23839760-23840381 rev: cggcacacagagaaatgatg   cagctacactctTTA------------tgtggaagaaac
mPL39 Chr.11; Position: for: gtggtttcccatccgtcata 1,3,5,7-10,14,16-24,26-28,30-31 atatcagtacggTTA <mPing (430bp) > TTAagaaacccaaca
  11010652-11011251 rev: cggctttatcagtgcaaggt   atatcagtacggTTA------------agaaacccaaca
  1. a Based on BlastN at the NCBI website.