Skip to main content

Table 1 Primer and TAQMAN probes used for the quantitative PCR experiments.

From: Coffee cysteine proteinases and related inhibitors with high expression during grain maturation and germination

Primers and Probes Sequences
rpl39-F1 5'GAACAGGCCCATCCCTTATTG3'
rpl39-R1 5'CGGCGCTTGGCATTGTA3'
rpl39-MGB1 5' ATGCGCACTGACAACA 3'
CP1-F1 5'ACACAGACCTCTTGATACCAAAACAT3'
CP1-R1 5'TCTTCCAAGAGCAAACCACCTT3'
CP1-MGB1 5' TCTGCTCTTCAGAGGTTGTA 3'
CP4-F1 5'CAGGATGCAACGTGGTGTTG3'
CP4-R1 5'CCTCCATTGCTATCCCACAAA3'
CP4-MGB1 5' TGCTGCTGAAGGCG 3'
CPI1-F1 5'TGTTTGGGAGATCTAATCTGATGATT3'
CPI1-R1 5'AAACCGAACACTTAACAGCAAAGA3'
CPI1-MGB1 5' TTAGTACCTTTCAGTGCAAAT 3'
CPI2-F1 5'CGCTATTGCCTATTTGCCTAGTAGA3'
CPI2-R1 5'GAAACTCCAATCTTTCCAACTGAAA3'
CPI2-MGB1 5' TAAAGCTAACGCGTAAATG 3'
CPI3-F1 5'AACCGACGCTGCAAGAATG3'
CPI3-R1 5'CAGGGTGGTGAGTAGGAGGAGAT3'
CPI3-MGB1 5' CTTCTGCCTTTCCC 3'
CPI4-F1 5'TGTTTATGGTGTGGCTTTCAGTTT3'
CPI4-R1 5'CGTAGGGAGACGTATGCATGAC3'
CPI4-MGB1 5' TGCATGGATGATGTACTG 3'
  1. All MGB Probes were labeled at the 5' end with the fluorescent reporter dye 6-carboxyfluorescein (FAM) and at the 3' end with the quencher dye 6-carboxy-tetramethyl-rhodamine (TAMRA), except rpl39 probe which was labeled at the 5' end with the fluorescent reporter dye VIC and at the 3' end with quencher TAMRA