Skip to main content

Table 2 Novel tobacco miRNAs identified in this study

From: Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)

Novel miRNAs Size (nt) Pre-miRNA hit Number of the mature miRNA reads (RPM) Mature miRNA sequence
    Root Leaf  
    Control Topping Wounding Wounding  
Nta-miR1 21 ET738113.1 2.3 16.6 204.9 123.7 TGGCAACTTCTTCATCATGCC
Nta-miR2 21 FH134894.1 12.7 24.5 28.1 15.2 TCAATTGAGATGACATCTAGT
Nta-miR3 22 FH179115.1 12.7 20.6 2.4 1.9 CATTTTCACATGTAGCACTGAC
Nta-miR4a.1 22 ET742627.1 16.1 14.9 11.6 3.7 AACAATTGAGATAACATCTAGG
Nta-miR4b 22 FH277271.1 16.1 14.9 11.6 3.7 TGCCAACTATTGAGATGACATC
Nta-miR4a.2 22 ET742627.1 5.2 14.5 719.5 396.2 TGCCAACTATTGAGATGACATC
Nta-miR4c 22 ET817133.1 0.3 0.2 9.4 6.6 TGCCAATTATAGAGATGACATC
Nta-miR5a 22 FH599068.1 4.9 4.2 2.5 1.5 TTTGTCCAATGAAACACTTATC
Nta-miR5b 22 ET748842.1 70.9 45.9 21.0 25.6 TTTGTCCAATGAAATACTTATC
Nta-miR6 21 FH715144.1 1.6 3.5 4.7 5.3 TGACATCTTCAAAACCCACTA
Nta-miR7 21 ET849487.1 6.8 8.7 0.2 0.0 TACGTCGATCGATTGTTCTTA
Nta-miR8 21 ET878171.1 5.9 1.9 3.3 0.2 TGTGTTAATCGTTTGTTCTCA
Nta-miR9a 21 ET872202.1 14911.6 29389.3 2155.8 1094.8 TTGATACGCACCTGAATCGGC
Nta-miR9b 21 ET886878.1 14911.6 29389.3 2155.8 1094.8 TTGATACGCACCTGAATCGGC
Nta-miR10 22 FH007932.1 4.2 7.7 42.8 21.6 TACAGGTGACTTGTAAATGTTT
Nta-miR11 22 FH363222.1 2.9 3.9 1.3 1.5 AGATTTGTTTGATCGTCTTGGC
Nta-miR12 22 FH007932.1 4.6 1.9 224.3 171.1 AGATACTCAGCAAAACATTTAC
Nta-miR13a 22 ET680982.1 0.2 0.4 1.3 0.6 TGAATGTGAGGCATTGGATTGA
Nta-miR13b 22 ET781387.1 0.2 0.4 1.3 0.6 TGAATGTGAGGCATTGGATTGA
Nta-miR13c 22 ET788684.1 0.2 0.4 1.3 0.6 TGAATGTGAGGCATTGGATTGA
Nta-miR13d 22 ET967981.1 0.2 0.4 1.3 0.6 TGAATGTGAGGCATTGGATTGA
Nta-miR13e 22 FH063511.1 0.2 0.4 1.3 0.6 TGAATGTGAGGCATTGGATTGA
Nta-miR13f 22 ET676102.1 0.2 0.4 0.4 0.2 TGAGTGTGAGGCATTGGATTGA
Nta-miR13g 22 ET780880.1 4.9 9.4 1.5 1.6 TGAGTGTGAGGCGTTGGATTGA
Nta-miR13h 22 ET858637.1 4.9 9.4 1.5 1.6 TGAGTGTGAGGCGTTGGATTGA
Nta-miR13i 22 FH085512.1 4.9 9.4 1.5 1.6 TGAGTGTGAGGCGTTGGATTGA
Nta-miR14 21 ET964891.1 9.4 65.0 17.6 10.2 TGAGTGTGAGGCGTTGGATTGA
Nta-miR15a 24 ET740537.1 0.0 0.0 3.4 3.2 TATTGTATTCGACTGTATTCACGG
Nta-miR15b 24 FH095578.1 0.0 0.0 3.4 3.2 TATTGTATTCGACTGTATTCACGG
Nta-miR16 21 FH440616.1 2.3 0.8 5.6 1.9 TTATCATACGTAGCACTAGCC
Nta-miR17 21 FH731935.1 354.2 52.6 116.5 54.4 TAGGACCATATTCACTATTTG
Nta-miR18a 21 ET783551.1 3.3 1.2 24.2 23.1 TGGGTCTCCTGGAGAAAGGTC
Nta-miR18b 21 FH988094.1 3.3 1.2 24.2 23.1 TGGGTCTCCTGGAGAAAGGTC
Nta-miR19 21 ET839854.1 2.3 6.0 13.4 5.1 TAAGGTTGCCTTGCTCTTGCA
Nta-miR20 21 FH374163.1 2.9 1.2 23.8 11.9 AGTGGGTGGAGTGGTAAGATA
Nta-miR21 20 FH383824.1 0.0 0.2 10.0 1.7 CAGTGCACATATAACAGTAA
Nta-miR22 21 ET704987.1 0.0 0.2 8.0 1.1 TTGAAGATGTTCTATTTCTGT
Nta-miR23 22 ET679542.1 58.5 62.3 0.4 0.2 TGGTAGACGTAGGATTTGAAGA
Nta-miR24a 21 FH052337.1 0.2 1.3 0.1 0.1 AAAATGTGGCCGGATACGTGT
Nta-miR24b 21 FH324277.1 0.2 1.3 0.1 0.1 AAAATGTGGCCGGATACGTGT
Nta-miR25 22 FH081190.1 2.6 20.2 389.8 12.9 TGAACTCTCTCCCTCAATGGCT
Nta-miR26a 21 ET837426.1 35.1 179.9 2.2 0.4 ATTGTTACATGTAACACTGGC
Nta-miR26b 21 FH393496.1 483.9 1146.6 1.5 1.3 ATTGTTACATGTAGCACTGGC
Nta-miR27a 22 FH905151.1 0.7 1.3 0.2 0.1 AAGTTCGATTTGTACGAAGGGC
Nta-miR27b 22 FH915892.1 0.7 1.3 0.2 0.1 AAGTTCGATTTGTACGAAGGGC
Nta-miR27c 22 FH918314.1 0.7 1.3 0.2 0.1 AAGTTCGATTTGTACGAAGGGC
Nta-miR28 22 FH253762.1 11.4 11.4 13.4 12.3 TAGCATAGAATTCTCGCACCTA
Nta-miR29 21 FH324206.1 0.0 2.1 0.0 0.0 ACGGGTGCGGCTACATTTTGG
Nta-miR30 21 FI086539.1 16.6 7.7 2.2 0.2 ATCGTAACATATAGCACTAGC
Nta-miR31 24 ET823610.1 0.0 0.0 0.9 0.6 GCATATATGGGCCAACTGTGTAAC
Nta-miR32 21 FH560937.1 0.0 0.0 1.6 1.7 TGAACTCCAGCATATTATACT
Nta-miR33a 24 FH761979.1 0.2 0.4 4.0 5.3 GCTGGACCGGTATACTTTGCTGAC
Nta-miR33b 24 FH762383.1 0.2 0.4 4.0 5.3 GCTGGACCGGTATACTTTGCTGAC
Nta-miR34 22 ET840416.1 1.6 24.7 13.2 7.8 TTCCCGACTCCCCCCATACCAC
Nta-miR35 21 FH119649.1 0.0 0.0 5.4 1.1 AGAAAAATGGTAGCCATTGGA
Nta-miR36 24 FH408012.1 0.0 0.0 21.6 27.3 AATATACTGGAGTTCGGTGCACCT
Nta-miR37 22 FH666318.1 0.0 0.0 3.3 0.4 TGGAAGTACTGCCTAAGTTTGA
Nta-miR38a 21 FH681839.1 0.8 1.0 0.5 0.1 TCACATAAATTGAAACGGAGG
Nta-miR38b 21 FH968988.1 0.8 1.0 0.5 0.1 TCACATAAATTGAAACGGAGG
  1. See Additional file 1: Table S1 for the detailed pre-miRNA sequences and their secondary structures