Skip to main content

Table 3 List of primers used

From: 'Le Rouge et le Noir': A decline in flavone formation correlates with the rare color of black dahlia (Dahlia variabilis hort.) flowers

Gene Primer   Sequence 5’→3’ Fragment size (bp)
  oligo(−dT) anchor primer   GACCACGCGTATCGATGTCGAC(T)16V  
FNS II FNS1 F CCCAACACCATGAATACACTCC  
  FNS4 R TCACCACTGAGAGTTCTCTCATGG  
FNS II FNSIIRub-ex F CCCAACACCATGAATACA C  
   R GAAGCGAAGGTAAACACA C  
FNS II Dah.FNSII.lang F CAACACCATGAATACACTCCTAGTACTCC  
   R CTTAGACTGAAGTAAACATCGAATGTGGAGAG  
FNS II qPCR F GCATCCAGAATCTCGGCCATT  
  qPCR R TCGTTGTCACTTCTCGCACTAG  
Actin qPCR F GGAAAAGATTTGGCATCACACTTTC 103
  qPCR R AGCCTTAGGATTTAAAGGTGCCTCA  
GAPDH qPCR F AGGCTGTTGGTAAGGTGTTGC 141
  qPCR R GCAGCCTTGATCTGCTCATAAG  
CHS1 qPCR F GCGCGTATATGGCACCTTCG 198
  qPCR R GGCCGAGGAGCTTGGTGAGT  
CHS2 qPCR F ACGTTTCGTGGACCGACGGAT 185
  qPCR R CAGCCCCACCTCCCTCAAG  
CHI qPCR F ACTTCCCTCCCGGCTCCTCT 182
  qPCR R TTGTTTGGCTGCTGGGGAAACAC  
FHT qPCR F CCACAGCCCGACCTGACACT 202
  qPCR R CGTTCTTGAACCGCCCATTG  
DFR qPCR F GCCAAAGCCAAGACGGTCAA 192
  qPCR R CGTTGCCTTCCATGCTGCTT  
ANS qPCR F GCTGCAGGCGAGGGTTTCTT 119
  qPCR R GTCGACGGCCAAATGGTGAG  
F3’H qPCR F AACTGCCTTGCTATTGTACGTACTG 147
  qPCR R TTTTCCGCCAGGGCTGCC  
MaT qPCR F TTGGAATATGCCGACCGATG 112
  qPCR R CCTTTCCCCACCCAAAATCA  
Delila qPCR F ATCTCACAAACGCCGAGTGGTATT 158
  qPCR R TGCTAGAAGAGAGCGGCAGAAGA  
IVS qPCR F CGTCGTCGAGAGAAGCTAAACGA 151
  qPCR R GACATCGTGCTTCCAAATCCTGAA  
MYB1 qPCR F TTGAGGAAAGGTTCATGGTCAGC 145
  qPCR R AATTTGTCCATCGTAGCCTGCAAC  
MYB2 qPCR F ACCCTCCTCCAACCACTCATCAT 160
  qPCR R TGAGGTGGGCTCATTCTCAACTC  
R3MYB qPCR F ATGGCCGTGAGAAGGAAATTGATG 153
  qPCR R CAAGGAGGTCCAACATGACAAC  
WDR1 qPCR F CGGTTGCGGAACTAGAGAGAC 155
  qPCR R TGACATCGGGTCAATCCCATTAGG  
WDR2 qPCR F CAGAGGCATCAGTCGAGTGTGA 149
  qPCR R GCCAATATCGGATCCAATCCACCT  
  1. Abbrev.: F: forward, R: reverse.