Skip to main content

Table 1 Details of the primers and mutation frequencies found for genes in the T. monococcum TILLING population

From: A diploid wheat TILLING resource for wheat functional genomics

Primer Name Gene Sequence 5′-3′ Number of mutants identified Product size No. of bases screened Gene-wise mutation frequency
W1_F waxy TTGCTGCAGGTAGCCACAC 13 931 1141034 1/90 kb
W1_R   CTCAAGTGCTGCCTGGCAGAGAA     
DOS_F   AGGACAACCAGCTACGCTTCAG 14 1058 1296685  
DOS_R   TGATGACGTACCAGGAGAACGA     
COMT1_AF COMT1 CATGTACGCTCTCCAGCTCGTCTC 6 379 464502 1/86 kb
COMT1_AR   AGCTCTCCATGAGGACCTTGTC     
COMT1_BF   GAACCACTCCATCATCATCACC 6 466 571130  
COMT1_BR   CGAACTCCCTCTCGTACCTCTC     
HCT2_AF HCT2 CGCCGAGCGTCTACTTCTTC 4 308 377485 1/92 kb
HCT2_AR   GAGGAGCGGGTAGGAGGAGAT     
HCT2_B   GGCCTGCACTTCATCAACTC 12 877 1074851  
HCT2_BR   CGGTGCTTCTTTCTTTCTGC     
4CL1_BF 4CL1 AGGACGCCTTCATGGCTAAGATCC 5 317 388515 1/100 kb
4CL1_BR   TCATGATCTGCTCGCCGCGGATGC     
4CL1_CF   AGAGTCCACCAAGAACACCATC 7 701 859146  
4CL1_CR   CTGGCTCTCAAGTCCTTCCTC