Skip to main content

Table 1 Primers Used for Gene Cloning and qPCR

From: Characterization of a calcium/calmodulin-regulated SR/CAMTA gene family during tomato fruit development and ripening

SlSR1-P1* ATGGCAGACAGTAGGCGTTA
SlSR1-P2* TCAAGGTGCTGTAGGCATAAAA
SlSR1L-P1* ATGGACATAACACAGATATTATCCG
SlSR1L-P2* TTATTCAAATGCTATAGACATGAAAGTA
SlSR2-P1* ATGGCAGAATCAGGATACAACACA
SlSR2-P2* TTAGACATGTCCATGAGCAGTTG
SlSR2L-P1* ATGGCGGAATCAGGATATGATATT
SlSR2L-P2* CTAGATGGATGATTGACTGACCT
SlSR3-P1* ATGGAAAGCAACAGAGCAGGAC
SlSR3-P2* CTAGTTATCAGGATTGATAAGCCTT
SlSR3L-P1* ATGGAAAGTAGCGTATCAGGACGA
SlSR3L-P2* TTAGTCCATCTCAGTGTCAGGATTG
SlSR4-P1* ATGGCAGTAGATCTTGAACAGATA
SlSR4-P2* CTAAACTGGTGGTGATGACCTA
SlSR1-A** CAGAAGGCTCTGGAAAGGGTAA
SlSR1-B** AAATCAACTGCTTCCGCTGAGT
SlSR1L-A** AAGTGAAGCAGGATGGTCCAAT
SlSR1L-B** ATTGGCTAATCAAGGGGGAAAA
SlSR2-A** CTTTGCACCCAGTTTTAAATGC
SlSR2-B** GTAACAGCTCCAGCAAATGCAC
SlSR2L-A** AAATGCTGAAGCCCTGAATTGT
SlSR2L-B** ATTGGCTAATCAAGGGGGAAAA
SlSR3-A** ACACAATAATGCTTCGCTGGAA
SlSR3-B** GGGGCAATATCACAATGCTTTT
SlSR3L-A** GCAATGGAAAGTAGCGTATCAGG
SlSR3L-B** GGCAAGTTTACAGGCTTGACATT
SlSR4-A** TTCTGGCCAAAATCCTCGTAAT
SlSR4-B** TTGTGAAAATGCAGGCTCTTGT
E4-A** ACCAGCAATATCTAGAGAAGGGTG
E4-B** ATCATTGTCATGTTTATTCAAATTTAAAG
Actin-A** GAAATAGCATAAGATGGCAGACG
Actin-B** ATACCCACCATCACACCAGTAT
  1. *Primers used for cloning; **Primers used for qPCR