Skip to main content

Advertisement

Table 3 Stress related gene primers used for qRT-PCR in SaSce9 transgenic Arabidopsis plants

From: A stress inducible SUMO conjugating enzyme gene (SaSce9) from a grass halophyte Spartina alterniflora enhances salinity and drought stress tolerance in Arabidopsis

Primer name Sequence (5’-3’)
AtTUBRTF ATAACCGTTTCAAATTCTCTCTCTC
AtTUBRTR TGCAAATCGTTCTCTCCTTG
AtRD22F GATTCGTCTTCCTCTGATCTG
AtRD22R TGGGTGTTAACGTTTACTCCG
AtP5CSF GAGGGGGTATGACTGCAAAA
AtP5CSR AACAGGAACGCCACCATAAG
AtNHX1F CCGTGCATTACTACTGGAGACAAT
AtNHX1R GTACAAAGCCACGACCTCCAA
AtSOS1F TCGTTTCAGCCAAATCAGAAAGT
AtSOS1R TTTGCCTTGTGCTGCTTTCC
AtSOD1F TCAACTGGAAATATGCAAGCGAGGT
AtSOD1R ACCACACAGCTGAGTTGAGCAAA
AtCATF AGCGCTTTCGGAGCCTCGTG
AtCATR GGCCTCACGTTAAGACGAGTTGC