Skip to main content

Advertisement

Table 2 Primers used for cloning and qRT-PCR of the SaSce9 gene

From: A stress inducible SUMO conjugating enzyme gene (SaSce9) from a grass halophyte Spartina alterniflora enhances salinity and drought stress tolerance in Arabidopsis

Primer name Sequence (5’-3’)
SaSce9RTF TCAGACTGCAGGCTAAGCAG
SaSce9RTR TGACCCAACGATTTTGTGAA
SaSceBglIIF GGAAGATCTATGTCTGGGGGTGGGGGAATC
SaSceSpeIR GGACTAGTTCAGACCAGTGCAGGATACTGCTTAGC
SaSceNheIF CTAGCTAGCATGTCTGGGGGTGGGGGAATC
SaSceBamHIR CGGGATCCTCAGACCAGTGCAGGATACTGCTTAGC
pCAMF GGAGAGAACACGGGGGACTCTTG
SaTUBRTF GAAGGTGATGAGGGTGATGAGT
SaTUBRTR TTCAAGCAAACAAGCCTTCATA