Skip to main content

Table 3 Profiles of the differentially expressed miRNAs responsive to Al stress

From: Identification of wild soybean miRNAs and their target genes responsive to aluminum stress

miRa_name Sequenced sequence raw_Al-free raw_Al-treated norm_ Al-free norm_ Al-treated Log2 (Al-treated/Al-free)
PCc-28-3p CATTTGGGCACCTATTTTGACTC 24 2 25.36 1.89 −3.74
PNb-miR164 TGGAGAAGCAGGGCACGTGCA 95 12 100.39 11.36 −3.14
PN-miR2111 CTAGTCCTTGGGATGCAGATTACG 57 10 60.23 9.46 −2.67
PC-1-5p TGGCCTGTGATGCATCAATTTGTC 49 10 51.78 9.46 −2.45
PC-4-5p GTCGTTGTAGTATAGTGGTAAGT 26 8 27.47 7.57 −1.86
PN-miR5044 GTAGTGGATGCCTAGAGGTCC 25 8 26.42 7.57 −1.80
PN-miR156b,c,d TGACAGAAGAGAGTGAGCAC 369 137 389.92 129.65 −1.59
gso-mir2109-p3 GGAGGCGTAGATACTCACACC 2655 1201 2805.55 1136.55 −1.30
PC-46-5p CTATATGATGAAGATA 52 26 54.95 24.60 −1.16
PN-miR1507c CCTCATTCCAAACATCATCTAA 377 194 398.38 183.59 −1.12
gso-miR2218 TTGCCGATTCCACCCATTCCTA 7282 19061 7694.91 18038.15 1.23
PN-miR169c AAGCCAAGGATGACTTGCCGA 17 47 17.96 44.48 1.31
PN-miR390b AAGCTCAGGAGGGATAGCACC 13 36 13.74 34.07 1.31
PN-miR862a, b GCTGGATGTCTTTGAAGGAAT 113 355 119.41 335.95 1.49
PC-39-5p TAGATTTTAAAGTTGCGGATCA 10 32 10.57 30.28 1.52
gso-mir1509a-p3 ACCGTGTTTCCTTGGTTAACG 9 34 9.51 32.18 1.76
PC-25-3p CTACATAAGGCACGAGATCATC 7 29 7.40 27.44 1.89
gso-mir1510a-p5 AGGGATAGGTAAAACAATGAC 6 25 6.34 23.66 1.90
PN-miR4387e-p5 TCACGCCTAATCACTGACGCA 11 49 11.62 46.37 2.00
PN-miR1514a TTCATTTTTAAAATAGGCATTGGG 11 51 11.62 48.26 2.05
PN-mir4415-p3 TTGATTCTCATCACAACATGG 41 243 43.32 229.96 2.41
PC-33-3p GGAGAACAAAGAAGCAGCTAAATTC 4 29 4.23 27.44 2.70
PN-miR4369 GGATCAAGCTGATCCGGAAGTGGA 3 23 3.17 21.77 2.78
PN-miR396a-1 TTCCACAGCTTTCTTGAACTG 81 676 85.59 639.72 2.90
PN-miR403a, b TTAGATTCACGCACAAACTTG 5 44 5.28 41.64 2.98
PN-miR1509b TTAATCAAGGAAATCACGGTTG 190 2232 200.77 2112.23 3.40
  1. a, miR_name is the name that was assigned to the detected miRNA sequences.
  2. b, PN means ‘potential novel’.
  3. c, PC means 'predicted candidate’.