Skip to main content

Table 3 Differential expression of soybean miRNAs that target TAS3 and TAS4 Gene Homologs in Soybean

From: Divergent patterns of endogenous small RNA populations from seed and vegetative tissues of Glycine max

    Normalized counts in each library per million readsa    
Sequence L miRBase Immature seed tissues Vegetative tissue miRNA gene originsb Putative TAS genec tasiRNA target and annotation
    WS SCR SCM SCW Cot GCot ST LE    
AAGCTCAGGAGGGATAGCGCC 21 gma-miR390 a/d/e/f-5p 456 116 166 113 275 132 20 193 Gm18: 5,047,835 Glyma09g03730.1 Glyma07g32300.1 AUX-IAA-ARF
            Gm18: 53,278,046 Glyma15g14670.1 Glyma13g24240.2 AUX-IAA-ARF
            Gm11: 30,272,772   
            Gm03: 6,558,249   
            Gm01: 42,335,625   
AAGCTCAGGAGGGATAGCACC 21 gma-miR390b/g-5p 24 6 2 2 153 60 165 12 Gm14: 47,097,986 Glyma09g03730.1 Glyma07g32300.1 AUX-IAA-ARF
            Gm12: 44,954,768 Glyma15g14670.1 Glyma13g24240.2 AUX-IAA-ARF
TCTTGCTCAAATGAGTATTCCA 22 gma-miR828 0 7 6 7 0 0 0 0 Gm12: 3,213,774 Glyma20g32510.1  
            Gm11: 9,033,043 Glyma10g35050.1  
  1. aLibrary abbreviations are in Table 1. bThe position of the miRNA hairpin in the Glycine max reference genome is shown. cThe gene model (Glyma number) of the putative TAS genes in soybean.
  2. L = sequence length.