Skip to main content

Table 2 Differential expression of soybean miRNAs

From: Divergent patterns of endogenous small RNA populations from seed and vegetative tissues of Glycine max

     Normalized counts in each library per million readsa    
  Sequence L miRBase Immature seed tissue Vegetative tissue miRNA gene originsb Target glyma cDNAs Annotation
     WS SCR SCM SCW Cot GCot ST LE    
1 TGAAGCTGCCAGCATGATCTT (see Figure 2A blot) 21 gma-miR167e/f 48472 54106 9009 72015 1540 8512 5 224 Gm20:37,901,914 20g02540.1 None
             Gm10:46,574,320 10g35160.1 Unknown function
2 TGAAGCTGCCAGCATGATCTG 21 gma-miR167c 65 412 37 281 782 9252 0 673 Glyma10g30370.1 20g02540.1 None
             Glyma20g36720.1*   
3 TGAAGCTGCCAGCATGATCTA 21 gma-miR167a/b 225 52 14 76 597 400 15 18 Glyma19g34240.1* 18g05330.1 Auxin response factor
             Gm10:2,640,290 02g40650.1
             Glyma02g16230.1* 11g31940.1
             Glyma03g31410.1* 14g38940.1
4 TAACTGAACATTCTTAGAGCAT (see Figure 2B blot) 22 gma-miR1512c 94395 36802 44554 64171 72 227 5 0 Gm02:8609718 08g17790.1 Cysteine-rich receptor-like kinase
              10g21350.1 Villin
5 CAGCCAAGGATGACTTGCCGG (see Figure 3A blot) 21 gma-miR169a 14 8 12 18 0 2042 7 32 Gm10:40,332,893 14g01360.1 Nuclear transcription factor
             Glyma09g28810.1*   
6 TGACAGAAGAGAGTGAGCAC_ 20 gma-miR156a 3331 2150 8462 2190 20788 22007 38342 31850 Gm17:4,291,733 05g38180.5 Squamosa PB-like TF
             Glyma17g08280.1* 08g01450.1
             Glyma17g33830.1* 06g17700.1
             Gm14:9,431,608 04g37390.1
             Gm13:20,521,472 05g00200.1
             Gm06:4,013,580 17g08840.1
             Gm04:4,257,067 03g27200.1
             Gm02:41,864,174 19g32800.1
7 TTGACAGAAGATAGAGAGCAC 21 gma-miR156c/d/e/g 290 4381 2889 2053 25 14252 13237 5014 Gm19:8,895,400 19g26390.1 Squamosa PB-like TF
             Gm09:37,843,837 13g24590.1
             Gm08g05430.1* 07g31880.1
             Gm07:9,347,149 18g36960.1
             Gm02:7,812,536 02g30670.1
             Gm08:3,891,372 19g32800.1
             Gm16:5331711 03g29900.1
8 TTGACAGAAGAGAGAGAGCAC 21 gma-miR156b/f 214 1631 3171 2018 98674 42110 9 51 Gm14:990,353 11g36980.1 Squamosa PB-like TF
  (see Figure 3A blot)            Gm02:50,779,324 18g36960.1
             Gm06:19,264,024 02g30670.1
              19g32800.1
              03g29900.1
9 TCGCTTGGTGCAGGTCGGGAA 21 gma-miR168b 1749 3565 1891 3244 1148 2935 1189 731 Glyma09g35160.1   
  (see Figure 3A blot)            Gm01:48,070,389   
10 TCGGACCAGGCTTCATTCCCC (see Figure 3A blot) 21 gma-miR166a-3p 4471 11557 16665 29735 12361 5812 24375 5460 Glyma16g02380.1* 08g21620.1 HD-zip transcription factor
             Glyma02g15860.1* 07g01940.1
             Glyma04g38430.1* 08g21610.1
             Glyma08g00630.1*   
11 GGAATGTTGTCTGGCTCGAGG 21 gma-miR166a-5p 10 154 500 252 230 45 23 182 Glyma16g02380.1*   
             Glyma08g00630.1*   
             Glyma04g38430.1*   
12 TGAGACCAAATGAGCAGCTGA (see Figure 3B blot) 21 gma-miR3522 3987 1849 4478 2524 112139 43366 1478 646995 Glyma15g06080.1* 07g31270.1 Tyrosinase
13 AGGGATAGGTAAAACAACTAC (see Figure 3B blot) 21 gma-miR1510b-5p 891 3293 16652 1798 9906 2809 2825 2028 Glyma02g08410.1*   
14 AGGGATAGGTAAAACAATGAC 21 gma-miR1510a-5p 428 0 5633 699 2628 221 0 0 Glyma16g27510.1*   
15 TGTTGTTTTACCTATTCCACC 21 gma-miR1510a/b-3p 31 20 65 18 132 34 9 0 Glyma16g27510.1* 04g39740.1 Disease-resistance protein
             Glyma02g08410.1* 18g14660.1
              19g07700.2 "
16 TCTCATTCCATACATCGTCTGA (see Figure 3B blot) 22 gma-miR1507a 29315 17502 5373 15728 17964 19959 34871 10750 Glyma17g08340.1* Glyma13g22280.1*   
17 AGCTCTGTTGGCTACACTTTG 21 gma-miR394a 19 693 2382 782 15 0 2412 11 Glyma17g38110.1   
18 TTCCACAGCTTTCTTGAACTG 21 gma-miR396a/e/h/i -3p 53 144 27 120 0 73 388 52 Glyma13g22840.1* 19g39020.1 Unknown function
             Gm17:35,366,632 03g00550.1 Retrovirus related Pol
             Gm14:13,971,439 13g22840.1 polyprotein
             Gm17:9,044,867   none
19 AGAATCTTGATGATGCTGCAT 21 gma-miR172a/b 2 32 10 25 8 30 349 616 Gm20:40,895,751 12g07800.1 AP2-like transcription factor
             Glyma13g39860.1* 11g15650.1
             Gm12:6,110,723 15g04930.1
             Gm10:31,592,580 13g40470.1
             Gm10:43,474,799 02g09600.1
20 CAGGGGAACAGGCAGAGCATG 21 gma-miR408c/a-5p 5 0 11 0 22 3 12 4669 Glyma10g27760.1* 11g01200.1 DNA-directed RNA
             Gm02:837,430   polymerase
21 TTGGCATTCTGTCCACCTCC 20 gma-miR394c-5p 286 102 71 147 13 2 412 0 Glyma17g38110.1* 18g00870.1 F-box protein
             Gm15:3,767,188 05g28050.1
             Glyma14g39920.1* 08g11030.1
             Gm08:9,880,084 11g36960.1
             Glyma06g02270.1*   
             Glyma05g30360.1*   
22 TAGAAAGGGAAATAGCAGTTG 21 gma-miR1508a/b 464 187 52 120 913 7892 704 1063 Gm16:32,903,801 09g30500.1 Pentatricopeptide
             Gm09:28,530,237 16g27800.1 repeat-containing protein
              09g39260.1
              09g39250.1
23 TAAGAGAATTGTAAGTCACTG 21 gma-miR4413 32 29 33 46 72 109 73 91 Glyma19g02070.1 09g07250.1 Pentatricopeptide
              07g11410.1 repeat-containing protein
              07g11290.1
              16g31950.1
              09g07300.1
              09g30620.1
  1. aNormalized read counts higher than 5000 are in bold. Library abbreviations are in Table 1. bThe position of the miRNA hairpin in the Glycine max reference genome or the associated gene Model number is shown. *Low confidence gene model. L= sequence length. Underline indicates base difference between family members.
\