Skip to main content

Advertisement

Table 5 Primer sequences used for the PCR analysis of putative transgenic regenerants

From: Analysis of T-DNA integration and generative segregation in transgenic winter triticale (x TriticosecaleWittmack)

Primer Sequence 5′ – 3′
35S-F2-C CATGGTGGAGCACGACACTCTC
35S-term-C CATGAGCGAAACCCTATAAGAACCC
GH-35S-term-F1 AATCACCAGTCTCTCTCTAC
GH-Hyg-F1 GATCGGACGATTGCGTCGCA
GH-Hyg-R2 TATCGGCACTTTGCATCGGC
GH-Ubi-F3 CCGTTCCGCAGACGGGATCGATCTAGGATAGGTA
GH-GFP-F1 GGTCACGAACTCCAGCAGGA
GH-GFP-R2 TACGGCAAGCTGACCCTGAA