Skip to main content

Table 5 Primers used in this study

From: Mutation of the cytosolic ribosomal protein-encoding RPS10Bgene affects shoot meristematic function in Arabidopsis

Primer name Sequence 5’ → 3’
RPS10B genomic construct
RPS10Bgenomic-F AAACTAGTAACCGAGTAAACGGGATGATTAGG
RPS10Bgenomic-R AAAAAAAGCTTAGCTCCTCAACATTCAACTCCTTC
RPS10B promoter::RPS10A, RPS10B and RPS10C cDNA constructs
RPS10Bpro-F GGATCC GCGGCCGCTGAATAAGTAACATCAAACTCCAGCTA
RPS10Bpro-R ATCATGATTGCGATGAGATTGAAGAAGGA
RPS10AcDNA-F CTTCAATCTCATCGCAATCATGATTATCTCAGAGAACAATCGCAG
RPS10AcDNA-R AATCTAGATCAAGGGAACCCTGAACCAGATGGTGCT
RPS10BcDNA-F CTTCAATCTCATCGCAATCATGATCATATCAGAGACTAACCGCCGT
RPS10BcDNA-R AATCTAGA TCAAGGAAGATCAGATCCAGCAGCA
RPS10CcDNA-F CTTCAATCTCATCGCAATCATGATTATCTCAGAGGCTAACCGCAAA
RPS10CcDNA-R AATCTAGATCAAGGCAAACCTGAACCAGATGGTGCA
RT-PCR
RPS10A-RT-F AGATTTGGTGACCGTGATGGATAC
RPS10A-RT-R CCTTCCATCGTCGCAATATGAC
RPS10B-RT-F AGGTTTGGTGACAGAGATGGATAC
RPS10B-RT-R AGACCAAAAAGAAACAAGAAAGTCC
RPS10C-RT-F GTTTGGTGACCGTGATGGGTAC
RPS10C-RT-R AACTCCTCCATGGTCTTACTGTC
CCD7-F CCGAGTCAAGCTTAATCCAATAG
CCD7-R ATTGCAGTTTCCGGTAGAGTCCAA
CCD8-F CATCGGCGATCAACAAATAA
CCD8-R GTTTAACCAAATCCGGTATC
Ubiquitin5-F AACCCTTGAGGTTGAATCATC
Ubiquitin5-R GTCCTTCTTTCTGGTAAACGT
Actin2-RT-F TTACCCGATGGGCAAGTCA
Actin2-AT-Rev CACCACTGAGCACAATGTTAC