Skip to main content

Table 2 Primer pairs used for RT-qPCR

From: Histone acetyltransferases in rice (Oryza sativaL.): phylogenetic analysis, subcellular localization and expression

Gene name Forward primer Reverse primer Amplification efficiency R2value
eEF-1α TTTCACTCTTGGTGTGAAGCAGAT GACTTCCTTCACGATTTCATCGTAA 90.60% 0.993
Ubq-1 AACCAGCTGAGGCCCAAGA ACGATTGATTTAACCAGTCCATGA 91.50% 0.993
PR10a AAGTCATGTCCTAAAGTCGGATG ATAGTAGCCATCCACGATGTCCT 107.80% 0.993
HAC701 TGGCGGTGCTTGGTTTGCCT ACGGGCACGGGTATGACATCGT 106.80% 0.982
HAC703 TGTTGAAGAGGTGAAACGTGGG GCTTCAACCGTTTAAAAAGCCGA 99.20% 0.985
HAC704 CAGTGACGAACCAGAGGAAGGGTG AGGCATGCGCAAACCACGTT 109.90% 0.981
HAF701 ACCAGTGCCGCAGATGACGA TCCGCCAGTGCAAAAAGGTGCT 109.70% 0.989
HAG702 TTGCTCGGCAGCTTCCTAACATGC CAGCATCTCGGGCATGTTGCTTCA 99.50% 0.997
HAG703 TGCTGCAAATGAGGGCTGGGA CGGCCACATTTTCGCAATCGCA 103.10% 0.985
HAG704 AAGCGGCTCGTCCAAATGCC TTGCCGCGTGAGGTGACGTT 93.10% 0.996
HAM701 ACCGGAGCGCCCTCTTTCTGAT AGAACCTTGGGGTCAGCGCA 99.80% 0.993
  1. Amplification efficiency and coefficient of determination (R2 value) for each primer pair were determined from a standard curve by RT-qPCR.