Skip to main content

Table 1 Abiotic stress-regulated miRNAs identified in rice inflorescences

From: High throughput sequencing reveals novel and abiotic stress-regulated microRNAs in the inflorescences of rice

MiRNA Family *Log2 (Drought/Ctrl) *Log2 (Cold/Ctrl) *Log2 (Salt/Ctrl) Putative target
AAUUCACAGGCCCUAUCUUGUG miR1428 −2.71 −0.82   −0.15   Cytochrome c
CUUGGAUUGAAGGGAGCUCU miR159 0.03   0.99   −1.57 MYB family transcription factor
UGCCUGGCUCCCUGUAUGCCA miR160 0.28   0.29   −1.07 Auxin response factor
UGCCUGGCUCCCUGAAUGCCA miR160 1.40 0.60   −0.37   Auxin response factor
GGAAUGUUGUCUGGCUCGGGG miR166 −1.69 −0.65   −0.96   START domain containing protein
GGAAUGUUGUCUGGUCCGAGA miR166 −2.68 0.08   −0.63   START domain containing protein
UGAAGCUGCCAGCAUGAUCUA miR167 1.02 0.81   −0.79   Auxin response factor
UAUGCGUAAGACGGAUUCGUA miR1856 0.72   1.29 0.95   
GAGGGAUUUUGCGGGAAUUUCACG miR1866 −4.67 −7.00 −1.49 Hypotethical protein
UUCAGUUUCCUCUAAUAUCUCG miR2275d 1.46 1.62 0.09   
CUUGUUUUUCUCCAAUAUCUCA miR2275e 1.37 1.83 0.15   
AUUGUUUUUCUCCAAUAUCUCA miR2275c 1.32 1.32 −0.02   
UAUUUUAGUUUCUAUGGUCAC miR2871 1.12 1.96 1.56 Glycosyltransferase family protein
UUGGACUGAAGGGUGCUCCC miR319 −0.46   −0.09   −1.46 TCP family transcription factor
UCCAAAGGGAUCGCAUUGAUC miR393 1.26 0.98   0.55   F-box domain and LRR containing protein
UCAGUGCAAUCCCUUUGGAAU miR393 0.99   1.08 0.21   MYB family transcription factor
UUGGCAUUCUGUCCACCUCC miR394 0.21   1.19 −2.94 F-box domain containing protein
UUCCACAGCUUUCUUGAACUG miR396 0.69   1.09 0.34   Growth regulating factor
UUCCACAGCUUUCUUGAACUU miR396 1.03 2.09 −0.14   Growth regulating factor
UCCACAGGCUUUCUUGAACUG miR396 1.17 1.32 0.06   Growth-regulating factor
UGGAAGGGGCAUGCAGAGGAG miR528 −0.70   −0.46   −1.39 Plastocyanin-like domain containing protein
AGAAGAGAGAGAGUACAGCCU miR529 1.41 1.35 0.79   SBP-box gene family
AGGUGCAGAGGCAGAUGCAAC miR530-3p −2.23 1.09 −2.06 Hairpin-induced protein 1 domain containing protein
UUGCUCUGAUACCAAUUGUCGG osa-cand027 2.35 0.60   −0.72   
GAAGCUGCAGCUGUCAGAAGCUCC osa-cand032 −0.01   −0.64   −1.18  
AAUGGCUUGUCUUGUUUUGUGUGC osa-cand042 −0.62   −2.82 −1.24  
UACAACUUCUUGUUGAUGGAAACU osa-cand052 −3.66 −7.49 −0.92   
UAAAUGGAGAGAACGAAAGAG osa-cand056 1.25 0.96   0.32   
  1. *Log2 ratio of normalized miRNA expression in stress and control libraries. Ctrl: control condition; ↑ and ↓: up- and downregulated in stress, respectively.