Skip to main content

Table 2 miRNA precursors and corresponding known and new miRNAs

From: miRNA regulation in the early development of barley seed

Row EST ID pri-miRNA miRNA miRNA sequence (5’-3’) Length RPM-A RPM-B RPM-C Star
1 U21_20916 hvu-MIR159a hvu-miR159 TTTGGATTGAAGGGAGCTCTG 21 2.74 2.16 1.29 YES
2 U21_9346 hvu-MIR168 hvu-miR168a TCGCTTGGTGCAGATCGGGAC 21 5891.89 16016.44 12430.78 YES
3 U21_38648 hvu-MIR171 hvu-miR171a TGATTGAGCCGTGCCAATATC 21 13.41 5.13 3.87 YES
4 U21_6953 hvu-MIR444a hvu-miR444a TTGTGGCTTTCTTGCAAGTCG 21 0.41 0.41 0.26 NO
5 U21_50801 hvu-MIR5051 hvu-miR5051 TTTGGCACCTTGAAACTGGGA 21 0.41 0.54 0.39 NO
6 U21_37849 hvu-MIR1135 Hvu-miR1135 TGCGACAAGTAATTCCGGACGGAG 24 0.27 0.68 1.68 NO
7 U21_8425 hvu-MIR1436b hvu-miR1436b TACATTATGGGACGGAGGGAG 21 0.82 1.08 0.26 NO
8 U21_2275 hvu-MIR5048 hvu-miR5048 TATTTGCAGGTTTTAGGTCTAA 22 111.82 122.18 89.92 YES
9 U21_14449 hvu-MIR5071b hvu-miR5071b TCAAGCATCATGTCATGGACC 21 0.55 0.54 0.26 NO
10 U21_51424 hvu-MIR6001 hvu-miR6001 CGAGGATGAAGAAGAAAAT 19 3.15 1.62 0.90 NO
11 U21_16909 hvu-MIR6002 hvu-miR6002 TAGGACGCCATGGTAGATAGCATG 24 0.00 1.22 1.03 NO
12 U21_27580 hvu-MIR6003 hvu-miR6003 AATATGGATCGGAGGGAGTAA 21 0.68 0.95 0.52 NO
13 U21_53039 hvu-MIR6004 hvu-miR6004 TTGCGTCGTTGTGCCTGGGCT 21 0.96 0.41 0.00 NO
14 U21_51897 hvu-MIR6005 hvu-miR6005 AATTAATTTGGATCGGAGGGA 21 0.41 0.27 0.65 NO
15 U21_16332 hvu-MIR1120 hvu-miR1120b TTCTTATATTATGGGACGGAG 21 4.11 4.46 5.29 NO
  1. The pri-miRNAs were identified in the harvEST dataset according to their ability to form a hairpin-like secondary structure that could generate one of the smRNAs present in the libraries. For each miRNA, its length and number of reads (in RPM) in each library (A, B, C) are indicated. The column “Star” indicates when a corresponding miRNA* was found in the libraries.