Skip to main content

Table 1 Primers used in this study

From: Identification of three MAPKKKs forming a linear signaling pathway leading to programmed cell death in Nicotiana benthamiana

Name Sequence (5’-3’) Comments
NbTC9992-1F GCTGTCAAAGAAGTGTCATTA Specific primer for TC9992
NbTC9992-1280R ACCGTTTATTAATCACTATATTGC Specific primer for TC9992
NtBP1333-1 F CTTAATGGGCAAGCAGCTAATC Specific primer for BP133312
NtBP1333-447R TCAAGATTGTATGTTGTCTGCTC Specific primer for BP133312
LeBI9315-123F GTTGCAATTAAACAAGTTTCTCTGGA Specific primer for BI931567
LeBI9315-658R GGCTGAAGATCATAGTACGG Specific primer for BI931567
NbTC9992-458R-5RACE GCTTGTCCATAGCCTTGGTTCTTCCT 5’-RACE for TC9992
NbTC9992-49R-5RACE TTTGCCTTCCCCCATCGCCTTGAT 5’-RACE for TC9992
NbTC9992-F1 GGATTGGAAAGGGGGAACCT Sequencing
NtMAP3Kb-566F TCCGCCGGTCATGTCACT Sequencing
NtBP1333-199R-5RACE ACATGGCTGCAGCTGCTTCATATTC 5’-RACE for BP133312
NtBP1333-91R-nested TACTATCCTTCTGCATAACTGACTGCAA 5’-RACE for BP133312
NtBP1333-333F-5RACE GAGAATCTCTCATCAGCCAGATGTTC 3’-RACE for BP133312
NtBP1333-375F-nested CAAACCTGTTGGTGGGGTACGAAT 3’-RACE for BP133312
NtBP1333-F1 AGACGCGCATAATTCGCATC Sequencing
NtBP1333-R1 TGAGCTCTCGTTTGGTAATAAG Sequencing
LeBI9315-507R-5RACE CATCTGCCTCTGTCAACTTTGTTGCA 5’-RACE for LeBI931567
LeBI9315-165R-nested CCTCCTGAGCAATATTCTCCAGAGA 5’-RACE for LeBI931567
LeBI9315-482F-3RACE TGCAACAAAGTTGACAGAGGCAGATG 3’-RACE for LeBI931567
LeBI9315-564F-nested ATGTCGGGAGTATGTGCTGCATCTG 3’-RACE for LeBI931567
LeBI9315-F1 CTGAGAAAGTTCTTGCAAACG Sequencing
LeBI9315-F2 GAACAGATGAATCAGAAGATG Sequencing
LeBI9315-F3 AAAGCACTCCATATAAACACAG Sequencing
LeBI9315-R1 GGTATACATCAAGTCCACCAT Sequencing
LeBI9315-R2 GAGGGAGTATGCTCTCATG Sequencing
Kp-NbMAPKKKa-1F GGGGTACCGAATGCCTGCTTGGTGGGGAA Full-length ORF of NbMAPKKKα
Xh-NbMAPKKKa-1836R GGCTCGAGTGCTAAAGAATTGGTCTTAGTTTTG Full-length ORF of NbMAPKKKα
Kp-NbMAPKKKb-1F CCGGTACCGAATGCATCGATTGCCAGGAATTTTTGC Full-length ORF of NbMAPKKKβ
EcV-NbMAPKKKb-1695R GGGATATCTTTAAAGCCTCTTGCCCAGATTTTG Full-length ORF of NbMAPKKKβ
Kp-NbMAPKKKg-1F GGGGTACCGAATGCGTTGGTGGCAGAACG Full-length ORF of NbMAPKKKγ
Xh-NbMAPKKKg-1956R GGCTCGAGTGCTACCTCTCTAGAGATAAACG Full-length ORF of NbMAPKKKγ
Kp-NbMAPKKKbkinase-F CCGGTACCGAATGTACTGGGACAAAGGTGATCT Kinase domain of NbMAPKKKβ
EcV-NbMAPKKKbkinase-R GGGATATCTTTACACAAAAGGATGCTCCAAGA Kinase domain of NbMAPKKKβ
Kp-NbMAPKKKgkinase-F GGGGTACCGAATGTGGCAAAAAGGGAAGCTTATTG Kinase domain of NbMAPKKKγ
Xh-NbMAPKKKgkinase-R GGCTCGAGTGTTACATAAATCGATGTTCCAATAAC Kinase domain of NbMAPKKKγ
Kp-NbMAPKKKekinase-F GGGGTACCGAATGAAATATATGCTCGGAGATGAG Kinase domain of NbMAPKKKε2
Xh-NbMAPKKKekinase-R GGCTCGAGTGTTATATCCATGGATGTGAAAGTAG Kinase domain of NbMAPKKKε2
NbMAPKKKb-K381M-F TTTTGCTGTCATGGAAGTGTCATTACTTGATCA K → M mutant of NbMAPKKKβ
NbMAPKKKb-K381M-R ATGACACTTCCATGACAGCAAAAAAGAAACCG K → M mutant of NbMAPKKKβ
NbMAPKKKg-K374M-F CTGGAGCTTTATGTGCGATGATGGAAGTTGAATT ATTACCGGA K → M mutant of NbMAPKKKγ
NbMAPKKKg-K374M-R TCCGGTAATAATTCAACTTCCATCATCGCACATAA AGCTCCAG K → M mutant of NbMAPKKKγ
NbMAPKKKa-255F GGTTGTTTTGGGATGTGGGGTCAG Real-time RT-PCR for NbMAPKKKα
NbMAPKKKa-393R CAGTGGGCTCAACCTATTATCGCC Real-time RT-PCR for NbMAPKKKα
NbMAPKKKb-1179F CACAAGGCAGATTTTACATGGTTTG Real-time RT-PCR for NbMAPKKKβ
NbMAPKKKb-1286R AGCTTGACCGATCCGTTAGCA Real-time RT-PCR for NbMAPKKKβ
NbMAPKKKg-903F CCGTGAGTGTAGTGCTCAGGGTAA Real-time RT-PCR for NbMAPKKKγ
NbMAPKKKg-984R TGCCGTAGGCTGCTGTGATG Real-time RT-PCR for NbMAPKKKγ
Nb18S-193F ATACGTGCAACAAACCCCGAC Real-time RT-PCR for Nb18S rRNA
Nb18S-280R TGAATCATCGCAGCAACGG Real-time RT-PCR for Nb18S rRNA