Skip to main content

Table 1 List of primers used for gene cloning and quantitative PCR experiments

From: RBCS1 expression in coffee: Coffea orthologs, Coffea arabica homeologs, and expression variability between genotypes and under drought stress

Gene name Source gene Primer name Primer sequence bp
UBI * SGN-U637098 BUBI-F
BUBI-R
5' AAGACAGCTTCAACAGAGTACAGCAT 3'
5' GGCAGGACCTTGGCTGACTATA 3'
104
GAPDH * SGN-U637469 GAPDH-F
GAPDH-R
5' TTGAAGGGCGGTGCAAA 3'
5' AACATGGGTGCATCCTTGCT 3'
59
RBCS1-Cc (CaCc) SGN-U617577
FR728242
C18244-F
C18244-R
5' CCGTCCTCTTCCCCTCAAAT 3'
5' CCTGAAAGTACAGCCCCAGTTC 3'
91
RBCS1-Ce (CaCe) SGN-U607188
AJ419826
E18244-F
E18244-R
5' TTGGCCCCGGCCCCTCAAATT 3'
5' CAGCTAAAAGTACAGCCCCAGTTC 3'
93
RBCS1-T   T18244-F
T18244-R
5' CTAGCATGGTTGCACCCTTCA 3'
5' AGTAATGTCGACGGACTTCTTGGA 3'
77
RBCS1-DNA   18244-F
18244-R
5' GAGAATGGCATCCTCAATGATCTC 3'
5' CAGCCCCAGTTCTCAATTTTATTG 3'
660(C)
648(E)
  1. Primers were designed using Primer Express software (Applied Biosystems). The source gene indicates the accession numbers of coffee cDNA and gene sequences found in the GenBank and SOL Genomics Network (SGN, http://solgenomics.net/content/coffee.pl[56]) libraries and used to design the primer pairs. The size of the amplicon is indicated in base pairs (bp). E: C. eugenioides corresponding to the CaCe (RBCS1-Ce isoform). C: C. canephora corresponding to the CaCc (RBCS1-Cc isoform). The RBCS1-T primer pair was used to amplify total-RBCS1 (CaCe+CaCc) transcripts. The RBCS1-DNA primer pair was used to amplify the CaCc cDNA and gene sequences. Primer sequences of reference genes previously reported by Barsalobres-Cavallari et al. [101] are also given (*).