Skip to main content

Table 2 Repeat families in the YE-IGS of Equisetum ramosissimum and E. arvense 1 sequence identified by VMATCH

From: Evolution of the rpoB-psbZ region in fern plastid genomes: notable structural rearrangements and highly variable intergenic spacers

Repeat familya Consensusb Size Copy Number
Equisetum ramosissimum   54
A YTATGGACWWDAAATCCATAR 21 13
B WCTGRACTCAAAATTCAGAATW 22 4
C AAGACCTATGGACATGAAATCCATAGGTTGA 31 4
D TAGCTRTGGACATAAAATCCATAGCT 26 4
E TTAATTAGTTCTTGACACAAAATCAAGAACT 31 3
F CTATGAACGTTGATAAGAACAC 22 3
G ATTAGYTCTTGACACAAAATCRAGAA 26 3
H ASCTMTGGACAATAAATCCATAGSTTG 27 3
I GAATTATGGACAAGAAATCYATA 23 3
J AGCTCTGGACATAAAATCCAGAGCTTTACGGTAG 34 2
K ACGATCTCTGGACAAAAAATCCATAGAT 28 2
L TTGGTGGTAAAAGCTATAGACAAGAAATCTATAGCTTG 38 2
M TGGACTCAAAATCCATAGGTTG 22 2
N TTTAGGTTCTTTACTTGCACTCTATA 26 2
O TAATTAGTTCTGGACTTAAAAT 22 2
P ATTGATTACTATATAATAAAT 21 2
E. arvense 1   84
A YTATGGACAAGAAATCCATARVT 23 19
B YTMTGGACTTAAAATCCATAGDTTK 25 17
C TAKAWCTCTGGACTTAAAATCCATAGDTT 29 7
D GTTTTATTTATGGACAAGAAATCCATAA 28 4
E TTATGGACTGTAAATCCATAR 21 3
F TTATGGACAAGAAATCCGTAACTATAGAACTAT 33 3
G GGGTTTTATTTATGGACAAGAAATCCATAGATTG 34 3
H TATAGTTATAGGTCTGGTGGTARA 24 3
I TTMTGGACAASAAATCYATAAGT 23 3
J TTGACAACAAATCCAKAATATCT 23 3
K TAAYTTCTAGACTCAAAATCTA 22 3
L TTTCTGGACAAGAAATCCRGAA 22 3
M GGTACGAYTTCTGGACAATAAATCCAGAATATATGT 36 3
N AATATCTATAGACTCCAAATCTATAGATATAGTTATAGGTTAGGT 45 2
O TTATGGACAAGAAATCCATAAATATAGGCT 30 2
P TTGGTGATATAACTCTGGACTTAAAATCCATAG 33 2
Q ATATCTATAGACTCCAAATCTATA 24 2
R ATATATGTATGGACCTGTTGACAACAAATCCATA 34 2
  1. a - Families of non-overlapping repeats sharing ≥ 85% sequence identities;
  2. b - The underlined DNA strings are mutually complementary and have potential to form a paired double helix. The putative secondary structures of the repeat families are provided in Additional file 3-4.