Skip to main content

Table 2 Small RNA sequences cloned from L. albus phloem exudate and matches of these to miRBase [28]

From: Macromolecular composition of phloem exudate from white lupin (Lupinus albusL.)

Name Sequence Length (nt) miRNA Mis matchesa
Phl71a UUUGGAUUGAAGGGAGCUC 19 Oryza sativa and Arabidopsis miR159 0 (2 nt short)
Phl344d UGGAGAAGCAGGGCACGUG 19 Arabidopsis miR164a,b,c 0 (2 nt short)
Phl51a UCGGACCAGGCUUCAUUCC 19 Oryza sativa and Arabidopsis miR166 0 (2 nt short)
Phl187c UCGGACCAGGCUUCAUUCCC 20 Maize miR166c,d,e,f,g,h,i 0
Phl340d UCGGACCAGGCUUCAUUCC 19 Maize miR166b,c,e,f,g,h,i 0 (1 nt short)
Phl32c UCGCUUGGUGCAGGUCGGG 19 Arabidopsis miR168a/b 0 (2 nt short)
Phl273a UCGCUUGGUGCAGGUCGGGUU 21 Arabidopsis miR168a/b 2
Phl79d UCGCUUGGUGCAGGUCGGGAA 21 Arabidopsis miR168a/b 0
Phl80a UCGCUUGGUGCAGGUCGGGA 20 Arabidopsis miR168a/b 0 (1 nt short)
Phl324a UCGCUUGGUGCAGGUCGGGAA 21 Arabidopsis miR168a/b 0
Phl260a UCGCUUGGUGCAGGUCGGGAA 21 Arabidopsis miR168a/b 0
Phl259c UCGCUUGGCGCAGGUCGGGA 20 Arabidopsis miR168a/b 1 (1 nt short)
Phl333c UCGCUUGGCGCAGGUCGGGA 20 Arabidopsis miR168a/b 1 (1 nt short)
Phl339b UGAGCCGAGGAUGACUUGCCGG 22 Arabidopsis miR169d,e,f,g 1 (1 extra nt)
Phl86d CUGAAGUGUUUGGGGG 16 Arabidopsis miR395 0 (5 nt short)
Phl86b UGCCAAGGGAGAGUUGCC 18 Arabidopsis miR399b,c 1 (3 nt short)
Phl224b CGCCAAAGGGGAGUUGCCC 19 Poplar trichocarpa miR399l
Vitis vinifera miR399i
1 (2 nt short)
  1. a (difference in length cf matched miRNA)