Skip to main content

Table 5 Summary of chickpea CBL- CIPK- and AGP-annotated UniTags in chickpea roots and nodules

From: The salt-responsive transcriptome of chickpea roots and nodules via deepSuperSAGE

  UniTag ID Sequence Uniprot ID Gene class R(ln)Roots R(ln)Nodules
CBL proteins STCa-10400 CATGCTTGTTATAGTTAGCCTTTCTC Q5EE13_9FABA CBL -0,21 -0,16
  STCa-8869 CATGCCTTACTTTGGGTGTGACGATT Q7FZ95_EUCGR CBL 0,89 -0,16
  STCa-12426 CATGGATGTGGAAAATGAAATCCTTG CNBLA_ARATH CBL 10 -0,90 0,53
  STCa-7792 CATGCATATGTACTGAACCCAGTTAA A4ZKI5_POPTR CBL 4-1 -2,00 -0,16
CIPK proteins STCa-4035 CATGAGTTTGAGATTTGTACTGTTGT Q8LK24_SOYBN CIPK 0,20 -0,16
  STCa-1179 CATGAAGAATCCTTGTTGATGATTCA Q8LK24_SOYBN CIPK 1,99 -0,38
  STCa-21948 CATGTGTTACTTGGGAGTGTCTGGTT A0MNJ9_POPTR CIPK 12 1,58 1,63
  STCa-19413 CATGTCAAACTACAGCAGCTGAAGCT A0MNK6_POPTR CIPK 19 -1,60 -0,85
  STCa-19111 CATGTATGTATGGATATATATATACT A0MNK8_POPTR CIPK 22 0,89 0,53
  STCa-5485 CATGATGTTATTATTTTTGATTTGAT A0MNL1_POPTR CIPK 25 -0,21 0,53
  STCa-21387 CATGTGGTGTTATTCTCTTTGTTCTT A0MNL1_POPTR CIPK 25 0,48 -1,55
  STCa-12635 CATGGCAAGGAGAACAACCACAGCAA A0MNL4_POPTR CIPK 6 -2,80 -0,72
  STCa-132 CATGAAAAGAATAGTGGGTAGTGTTT CIPK7_ARATH CIPK 7 -0,21 -0,85
  STCa-6698 CATGCAATGTAATATAAGACCCTAAT CIPK9_ARATH CIPK 9 -1,19 1,92
AGP proteins STCa-17547 CATGTAATGTAATATTGTTGAATGAA Q8L5F8_CICAR AGP -- 0,53
  STCa-18898 CATGTATCATTTATTTTCTTTTTTTG Q9XIV1_CUCSA AGP 1,40 0,53
  STCa-17548 CATGTAATGTAATATTGTTGTGAAAA Q8L5F8_CICAR AGP 0,89 --
  STCa-17550 CATGTAATGTAATATTGTTGTGATTT Q8L5F8_CICAR AGP -0,12 0,28
  STCa-23251 CATGTTGATGTTGGAGAGAGGGCTTT AGP20_ARATH AGP 0,53 0,22
  STCa-17544 CATGTAATGTAATATCGTTGTGATTT Q8L5F8_CICAR AGP 0,48 --
  STCa-17549 CATGTAATGTAATATTGTTGTGATTA Q8L5F8_CICAR AGP 0,48 --
  STCa-19513 CATGTCACAACTCATAAAAAAGTACA Q8L5F8_CICAR AGP -- -0,16
  STCa-21051 CATGTGGAGTAGTTTGATTTGTGCAG Q8L5F8_CICAR AGP -0,21 --
  STCa-635 CATGAAATGTAATATTGTTGTGATTT Q8L5F8_CICAR AGP -- -0,85
  STCa-23101 CATGTTGAAGTGAAATATGAAATGAA A7J385_GOSHI AGP 0,48 -0,85
  STCa-8606 CATGCCCTCACCTCTCCTTTCATCAT AGP25_ARATH AGP -1,60 -1,55