Skip to main content

Table 1 Details of SCAR markers from BnA7.SUT1 showing significant associations (P value) with yield-related traits in the set of 55 genetically diverse Brassica napus genotypes

From: Characterization of Sucrose transporter alleles and their association with seed yield-related traits in Brassica napus L

Symbol Primer Primer sequence Length Product(bp)
  name   Eagle S-1300
PT1 PT1-L ATGTTCGCTGGCATACCTAG 1600 -
  PT1-R TTCCGACCAATCCACTCAAC   
PT5 PT5-L ATATACAGCATGAACGCAAC - 600
  PT5-R ATGAGAGAGGACCATTTGTG   
ET3 ET3-L GTTGTAGAGACACAGCCACCTTC 1250 -
  ET3-R CGGCAGTTTTCCGGTGAC   
ET4 ET4-L GTTGTAGAGACACAGCCACCTTC - 850
  ET4-R TTCGTCGCCGGAGTTTGG   
\