Skip to main content

Table 4 Primers used for fine mapping.

From: Genetic variation of γ-tocopherol methyltransferase gene contributes to elevated α-tocopherol content in soybean seeds

Primer name Direction Nucleotide sequence (5' to 3')
KSC138-9 Forward GCACAATAAATTGGGCCTGA
  Reverse GCGAGTGTTGGGCTAAGTCT
KSC138-10 Forward CACGAATGTGAATTTGATCG
  Reverse CGACCAAGGAGATAAAAACAGA
KSC138-17 Forward TGGAAATTCTGTGCACTTGGTG
  Reverse TAAAGCCGCCTAGCCGATTG
KSC138-22 Forward TGCAGCAATAATCAATCAAATAGAA
  Reverse TTCAATCAAATTTAGCACGTGTATT
KSC138-23 Forward CGGTCCAGATTTAATTCTTTCACTC
  Reverse TTTCCGTTTTGTCACCCTGCT
BARCSOYSSR_09_1388 Forward TTGCACTCTCCAAACCAAGA
  Reverse ATGCACTCTGCTCGACACAT
BARCSOYSSR_09_1415 Forward CACCATCCACTCCAGTTCCT
  Reverse CTCCACGTGTTAGACGGGTT