Skip to main content

Table 1 Primers for qRT-PCR analysis

From: Tic20 forms a channel independent of Tic110 in chloroplasts

primer forward reverse
PsTic20 CCTAGATGGTCTCTCATAGC GCAGTAGTCCAGAAATGC
PsTic110 CAAGGAAACTGCTCTGTC CTCCTTTGATGTCCTCTACC
Ps18SrRNA CCAGGTCCAGACATAGTAAG GAGGGTTACCTCCACATAG
AtTic20-I AGGTTATAGGGACCGTTAGC CTTAGTCGTACGGAATCTGG
AtTic20-IV CTATGTCCAACCTTTTCTCG CTGTTTCAAGAAGCATACCC
AtTic110 CTAAAGGAGTGGTCTTGTCG GCAGAAGATAATGCTCCATC
At18SrRNA AACTCGACGGATCGCATGG ACTACCTCCCCGTGTCAGG
  1. Gene-specific primers generated for PsTic20, PsTic110, Ps18SrRNA, AtTic20-I, AtTic20-IV, AtTic110 and At18SrRNA applied in the qRT-PCR analysis.