Skip to main content

Table 1 Primers used for real-time quantitative RT-PCR analysis.

From: A single amino acid change within the R2 domain of the VvMYB5b transcription factor modulates affinity for protein partners and target promoters selectivity

Gene Accession Sequence (5'-3') Amplified fragments size (bp)
VvMYB5b AY899404 F: GCCATGACTTCCACGTCTG
R: CATTGCAGGGTGTTGAAGCC
115
NtCHS AF311783 F: GGTTTGGGAACTACTGGTG
R: CCCACAATATAAGCCCAAGC
126
NtANS EB427369 F: TCCATCTGGCCTAAAATCCCT
R: AACGCCAAGTGCTAGTTCTGG
226
NtDFR EF421429 F: CGCGTCCCATCATGCTATC
R: AATACACCACGGACAAGTCC
116
NtUbiquitin NTU66264 F: GAAAGAGTCAACCCGTCACC
R: GAGACCTCAAGTAGACAAAGC
138