Skip to main content

Advertisement

Table 1 Genes, primers and amplicon characteristics

From: Validation of reference genes for quantitative real-time PCR during leaf and flower development in Petunia hybrida

Gene name Molecular function Accesion Tblastx e-value Primer sequences (forward/reverse) Length (bp) Efficiency
ACT Actin 11 SGN-U208507 (At3 g12110.1) 2e-110 TGCACTCCCACATGCTATCCT/TCAGCCGAAGTGGTGAAAGAG 114 1.75 ± 0.07
CYP Cyclophilin SGN-U207595 (At2 g21130.1) 1.9e-75 AGGCTCATCATTCCACCGTGT/TCATCTGCGAACTTAGCACCG 111 1.64 ± 0.10
EF1α Elongation factor 1-alpha SGN-U207468 (At5 g60390.1) 0 CCTGGTCAAATTGGAAACGG/CAGATCGCCTGTCAATCTTGG 103 1.62 ± 0.08
GAPDH Glyceraldehyde-3-phosphate dehydrogenase SGN-U209515 (At1 g42970.1) 9.2e-79 AACAACTCACTCCTACACCGG/GGTAGCACTAGAGACACAGCCTT 135 1.83 ± 0.09
RPS13 Ribosomal protein S13 SGN-U208260 (At4 g00100.1) 4e-77 CAGGCAGGTTAAGGCAAAGC/CTAGCAAGGTACAGAAACGGC 114 1.70 ± 0.04
RAN1 GTP-binding nuclear protein SGN-U207968 (At5 g20010.1) 1e-119 AAGCTCCCACCTGTCTGGAAA/AACAGATTGCCGGAAGCCA 103 1.71 ± 0.07
SAND SAND family protein SGN-U210443 (At2 g28390.1) 8.2e-76 CTTACGACGAGTTCAGATGCC/TAAGTCCTCAACACGCATGC 135 1.61 ± 0.12
TUB Tubulin beta-6 chain SGN-U207876 (At5 g12250.1) 6e-147 TGGAAACTCAACCTCCATCCA/TTTCGTCCATTCCTTCACCTG 114 1.61 ± 0.05
UBQ Polyubiquitin SGN-U207515 (At4 g02890.2) 8e-107 TGGAGGATGGAAGGACTTTGG/CAGGACGACAACAAGCAACAG 153 1.67 ± 0.02
  1. Selected candidate reference genes accessions are shown as identifiers of Solanaceae Genomics Network (SGN) and Arabidopsis TAIR databases (in brackets). Homologous Arabidopsis genes were determined on the basis of tblastx e-values