Skip to main content

Table 1 Description of primers used in the study

From: An unedited 1.1 kb mitochondrial orfB gene transcript in the Wild Abortive Cytoplasmic Male Sterility (WA-CMS) system of Oryza sativa L. subsp. indica

Primers Base sequence 5' to 3' Tm Purpose
atp6-5' GCTGGGATCCATGAATTTCGATCACAATCATG 62°C PCR primer for the atp6 gene probe
atp6-3' CGGCGAGCTCTTACTCATTTTGATGGAGATT 62°C PCR primer for the atp6 gene probe
atp9-5' CGGCGGATCCATGTTAGAAGAAGGAGCTAAATA 63°C PCR primer for the atp9 gene probe
atp9-3' CGGCGAGCTCCTATTTGCAAAGAGAGATATC 63°C PCR primer for the atp9 gene probe
atpA-5' ATATCTGCAGCATGGAATTCTCACCCAGAGCTGG 66°C PCR primer for the atpA gene probe
atpA-3' AGCAGGATCCGAAGCGGTGGCTGCTACAA 66°C PCR primer for the atpA gene probe
orfB-5' GCTGGGATCCATGCCTCAACTTGATAAATTGAC 63°C PCR primer for the orfB gene probe T-PCR
orfB-3' CGGCGAGCTCTTAGATTATGCTTCCTTGCC 64°C PCR primer for the orfB gene probe T-PCR
AOT GCGGCCACGGATCCGTCGAC
T15V(A/G/C)N(A/T/G/C)
- Oligo-dT adaptor primer for 3' RACE of orfB gene
O-GSP1 CGACGGATCCAAGAATTTGGAAGATATCTT 66°C 5' Gene-specific primer for 3' RACE of orfB gene
RACE AMP GCGGCCACGGATCCGTCGAC 62°C 3' RACE primer
Corf GTCAGGATCCGGTGCTAAAACCTTTTCTC 62°C 3' Gene-specific primer for 5' RACE of orfB gene and RT-PCR
AAP GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG - Abridged anchor primer for 5' RACE of orfB gene
AUAP GGCCACGCGTCGACTAGTAC - Abridged universal amplification primer for 5' RACE of orfB gene
orfB-UTR TAGCAAGCTTCTACTACAGTATCGGCCTCG 66°C 3' Gene-specific primer for preparation of 1.1 kb specific northern probe.
Mtg-1 TCGAGAGCTCGGATAATCCGCATCAAGAAG 62.5°C 5' Gene-specific primer for preparation of 1.1 kb specific northern probe and RT-PCR.
FP-24 CGCCAGGGTTTTCCCAGTCACGAC 63°C pUC18 forward sequencing primer
RP-24 AGCGGATAACAATTTCACACAGGA 54°C pUC18 reverse sequencing primer
  1. Restriction sites indicated in bold.